ID: 1033542482

View in Genome Browser
Species Human (GRCh38)
Location 7:142369653-142369675
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542478_1033542482 0 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542477_1033542482 5 Left 1033542477 7:142369625-142369647 CCTAACCCAAATGCACAGACTGT No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542476_1033542482 6 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542474_1033542482 25 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542479_1033542482 -1 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542475_1033542482 24 Left 1033542475 7:142369606-142369628 CCACAGTCACTGCACTCTCCCTA No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542482 Original CRISPR CAAGCCATATGGCCACTGCC AGG Intergenic