ID: 1033542488

View in Genome Browser
Species Human (GRCh38)
Location 7:142369661-142369683
Sequence ATGGCCACTGCCAGGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542478_1033542488 8 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542479_1033542488 7 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542476_1033542488 14 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542477_1033542488 13 Left 1033542477 7:142369625-142369647 CCTAACCCAAATGCACAGACTGT No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542488 Original CRISPR ATGGCCACTGCCAGGGGATG GGG Intergenic
No off target data available for this crispr