ID: 1033542489

View in Genome Browser
Species Human (GRCh38)
Location 7:142369662-142369684
Sequence TGGCCACTGCCAGGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 6, 1: 16, 2: 55, 3: 130, 4: 717}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542478_1033542489 9 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717
1033542476_1033542489 15 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717
1033542479_1033542489 8 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717
1033542477_1033542489 14 Left 1033542477 7:142369625-142369647 CCTAACCCAAATGCACAGACTGT No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542489 Original CRISPR TGGCCACTGCCAGGGGATGG GGG Intergenic
900462974 1:2810204-2810226 TGGGCACGGCTAGGGGAGGGCGG - Intergenic
900552556 1:3264108-3264130 TCGCTTCTTCCAGGGGATGGTGG - Intronic
900772345 1:4555326-4555348 TGGCGTATTCCAGGGGATGGGGG - Intergenic
900848827 1:5125893-5125915 AGGCCCCTGAGAGGGGATGGTGG - Intergenic
900853354 1:5161565-5161587 TGGCCACTGGGAGGGGCTGCAGG + Intergenic
901005793 1:6170969-6170991 TGGGCACCGCCAGGGTGTGGGGG - Intronic
901308916 1:8253943-8253965 TGGTGGCTGCCAGGGGATAGGGG - Intergenic
901410837 1:9082903-9082925 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
901521420 1:9787910-9787932 TGGTGGCTGCCAGGGGCTGGGGG - Intronic
901637756 1:10678214-10678236 TGGCCTCAGCAAGGGGATTGTGG - Intronic
901778592 1:11577513-11577535 TGACCAGTGCCAGAGGATGCAGG - Intergenic
902587183 1:17447150-17447172 TGCCCACTGGCAGGGGAAGATGG - Intergenic
902616271 1:17625175-17625197 TGGGCCCTGGCGGGGGATGGTGG + Intronic
902625225 1:17672494-17672516 GGGCCACTGCCAGAGCATGCAGG + Intronic
902694505 1:18131128-18131150 TGGCCACTGCTAGAGGAAAGGGG + Intronic
903322850 1:22553071-22553093 TGGCCACTGCCTCTGGGTGGCGG - Intergenic
903471989 1:23593716-23593738 AGGCCACTGCCAGGTGTGGGTGG + Intronic
903595241 1:24489129-24489151 TGGCAGCTACCAGGGGCTGGGGG + Intergenic
904811447 1:33165628-33165650 TGACCACTGCCAGGCGCTGGGGG + Intronic
905142652 1:35860359-35860381 TTGCCACTGTCTGGGCATGGTGG - Intergenic
905368782 1:37471534-37471556 TGGTCACTGCCTGAGGGTGGTGG - Intergenic
906772335 1:48496154-48496176 TTGCCAATGCCTGGGGATGTAGG - Intergenic
906915369 1:50004072-50004094 TGGCTTCTGCCAGAGGATGGGGG - Intronic
907614171 1:55907069-55907091 TGTCCACAGCCTGGGGGTGGGGG - Intergenic
908600814 1:65738020-65738042 TGGGGACTGTCAGGGGGTGGGGG - Intergenic
908807704 1:67948050-67948072 TGGCCTCTTCCAGGTGATGGTGG - Intergenic
908843056 1:68297840-68297862 CAGCCACTGGCAGGGGAAGGGGG - Intergenic
909043411 1:70681206-70681228 TGTACACTGCCAGGTGATGAAGG + Intergenic
909309710 1:74130465-74130487 TGGCCACTGCCAGAGTGTGGGGG + Intronic
909378073 1:74962838-74962860 TTGCCAGTGCCTGGGAATGGTGG - Intergenic
909438503 1:75672236-75672258 TGGCTAACTCCAGGGGATGGGGG - Intergenic
909677309 1:78252668-78252690 TGGCCACTGACAGAGGGAGGTGG + Intergenic
910289645 1:85587995-85588017 TGGCTGCTGCCAGAGAATGGGGG - Intergenic
910776911 1:90886191-90886213 GGGCCACTGCCAGGGTGTGGAGG - Intergenic
910819440 1:91329889-91329911 TGGCCAGTGGGAGGTGATGGTGG + Intronic
911361461 1:96882276-96882298 TGGTGATTGCCAGGGGCTGGGGG + Intergenic
911373489 1:97023459-97023481 TTGCCACTGCCAGGGGATGTGGG - Intergenic
911925662 1:103828461-103828483 TGGTACCTGCCAGGGGTTGGAGG - Intergenic
912093929 1:106115999-106116021 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
912190755 1:107337436-107337458 TGGTGACTGCCAGGGGCTGGGGG + Intronic
912633384 1:111268357-111268379 TAGCCACTGCCAGGGGATGCAGG + Intergenic
913038089 1:114993890-114993912 TGGTGACTGCCAGGGCCTGGGGG - Intronic
913098773 1:115544280-115544302 TAGCGATTGCCAGGGAATGGTGG + Intergenic
913699459 1:121360618-121360640 GGGCCAGTGCTAGGTGATGGTGG - Intronic
914138086 1:144919418-144919440 GGGCCAGTGCTAGGTGATGGTGG + Intronic
914676024 1:149908148-149908170 AGTCCACTGCCTGGAGATGGCGG + Exonic
914797923 1:150937307-150937329 TGGTGGCTGCCAGGGGCTGGAGG + Intronic
915215978 1:154341049-154341071 TGGCCACAGCTATGGTATGGTGG + Exonic
915341612 1:155179575-155179597 TGGCCACTGGCCTGGCATGGAGG - Intronic
915526326 1:156478489-156478511 TGTCCGCTGCCAGGGGTTGGGGG + Intronic
915640611 1:157221644-157221666 GGGTCATTGCCAGGGGCTGGGGG - Intergenic
915973370 1:160369110-160369132 TGGCCGTTGCCAGGGGCTGGAGG - Intronic
916360462 1:163962071-163962093 TGGCCACTCCCAGGAGATGAGGG - Intergenic
916598997 1:166274299-166274321 TGGTGACTGCCAGGGGCCGGAGG - Intergenic
917191236 1:172421793-172421815 TGGCTGCTGCCAGGGGATGGGGG - Intronic
917346536 1:174033965-174033987 CTGCCACTGCCAGTGGATGCTGG - Intergenic
918544939 1:185671847-185671869 TGGCCAAAGACAGAGGATGGGGG - Intergenic
918733546 1:188029620-188029642 TGATGATTGCCAGGGGATGGGGG + Intergenic
919067650 1:192713841-192713863 TGGCCACTGCTGGGGGATAGGGG - Intergenic
919163818 1:193867178-193867200 AGGGAACTGCCAGAGGATGGAGG - Intergenic
919257605 1:195143457-195143479 TGGCTACTGCCAGGGAATGGAGG + Intergenic
919336493 1:196243484-196243506 TGGCCACTGCCAAAAGATAGGGG - Intronic
919422612 1:197389514-197389536 TGGCGACTGCCAGGGGCTGAGGG + Intronic
919835549 1:201570667-201570689 GGGCCAGGGCCAGGGTATGGGGG + Intergenic
920071358 1:203305423-203305445 TGGTCGCGGCCAGAGGATGGGGG - Intergenic
920336612 1:205249367-205249389 TGGCAAGAGCCAGGGGTTGGGGG - Intronic
920486868 1:206379326-206379348 GGGCCAGTGCTAGGTGATGGTGG - Intronic
921525017 1:216206601-216206623 TGTCCACAGCCTGGGGATTGGGG + Intronic
921769639 1:219021426-219021448 CAGCCACTGCTAAGGGATGGAGG - Intergenic
921929514 1:220743603-220743625 TGGCCACTGCCAGGAGACTGGGG + Intergenic
922320604 1:224483089-224483111 TGACCACTGGCAGGGGAATGGGG + Intronic
922602738 1:226869850-226869872 TGGTAATTGCCAGGGGCTGGGGG + Intergenic
922816715 1:228454298-228454320 TGGTGGCTGCCAGGGGCTGGAGG - Intergenic
923150587 1:231229813-231229835 TGGTGGCTGCCAGGGGCTGGAGG + Intronic
923317680 1:232797041-232797063 TGACCATGGCCAGGGGTTGGGGG - Intergenic
924508175 1:244705483-244705505 GGTCCACTGCCAGGGAGTGGAGG - Intronic
1062822344 10:543922-543944 TGGCGATTGCCAGGGGCTGGCGG - Intronic
1062907200 10:1187088-1187110 TGGCCACAGACAGGTGATGTGGG + Intronic
1063102187 10:2960030-2960052 TGGGACCTGTCAGGGGATGGGGG + Intergenic
1063866067 10:10366921-10366943 TCCCCATGGCCAGGGGATGGGGG + Intergenic
1064446454 10:15398295-15398317 TGGCCACTGCCAGGGGATGAGGG - Intergenic
1064521800 10:16210341-16210363 TCACCACTGCAAGGGGATAGGGG + Intergenic
1065118804 10:22508209-22508231 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
1065427014 10:25616240-25616262 TGGCTACTGTGAGGGGATGGGGG + Intergenic
1065431569 10:25662110-25662132 TGGCTGCTGCCAGGAGATGAGGG + Intergenic
1066499334 10:35974642-35974664 TGGCAACTGCCAAGGGACTGGGG + Intergenic
1066627165 10:37418541-37418563 TGGCAACTGCCAAGGGACTGGGG + Intergenic
1067167888 10:43879819-43879841 TGACCACAGCCAGGGGAGGGTGG + Intergenic
1067266538 10:44750322-44750344 TGGTCACTGCCAAGGGCTGGAGG + Intergenic
1067349788 10:45465423-45465445 AGGCCTCAGCCAGGGAATGGTGG - Intronic
1067522487 10:47018605-47018627 TGGCAGCTGCTAGGGGCTGGCGG + Intergenic
1068226055 10:54108271-54108293 TGTCTTCTGCCAGGGGATGGGGG - Intronic
1068539454 10:58274631-58274653 TGGCCCTTGCTAGGGGTTGGGGG + Intronic
1068556560 10:58465195-58465217 TGGCCACTGTGAGGGGTTGGGGG + Intergenic
1069050556 10:63788255-63788277 TGGCCTCTGCTAGGGGACAGGGG - Intergenic
1069050610 10:63788631-63788653 TGGCCTCTGCTAGGGGACAGGGG + Intergenic
1069193580 10:65520359-65520381 TGGCTGCTGCCAGGGGATTAAGG + Intergenic
1069260462 10:66387933-66387955 TGGGGCCTGTCAGGGGATGGAGG + Intronic
1069343305 10:67438684-67438706 TGGTCACTGCCTGGAGATTGGGG - Intronic
1069570148 10:69489840-69489862 TGACCCCAGCCAGGGGCTGGAGG + Intronic
1069629813 10:69890587-69890609 GGGGCACTGCCAGGGCATGGAGG + Intronic
1069677083 10:70255870-70255892 GGGCCCCTGCGAGGGGACGGTGG + Intronic
1069749287 10:70735315-70735337 TGGCCTCTGCCAGGTGGTTGGGG + Intronic
1069794301 10:71042453-71042475 TGGCCACGACCAGAGGCTGGAGG + Intergenic
1069946665 10:71991074-71991096 TTGCCACAGCCAGGGGAGAGAGG + Intronic
1070596218 10:77834819-77834841 TGCCCAGTGCAAGGGGAGGGAGG - Intronic
1070648846 10:78220591-78220613 TGGCCAGTGCCAGCAGATGCTGG - Intergenic
1071000275 10:80823799-80823821 TGGTGACTGTCAGGGGCTGGGGG + Intergenic
1071742483 10:88375910-88375932 TTGGCACTTCCAGGGGATGGTGG + Intronic
1072195408 10:93113632-93113654 TGGTCACTGTCAGGAGAGGGAGG + Intergenic
1072344437 10:94489368-94489390 AAGCCACTGCCAGGGGTTGGGGG + Intronic
1072623197 10:97094232-97094254 GGGCCACTGCCAGGCCATAGGGG + Intronic
1072842919 10:98795315-98795337 AGGCTGCTGCCAGGGGATGTGGG - Intronic
1072853770 10:98925079-98925101 TGGCCACTGCTAGGGGATGGAGG + Intronic
1074128259 10:110548208-110548230 TAGCTACAGGCAGGGGATGGGGG - Intergenic
1074705912 10:116131731-116131753 TGGCTGCTTCCAGGGAATGGGGG + Intronic
1075194854 10:120347702-120347724 CAGCCACTGCCAGGGGATGGAGG - Intergenic
1075234526 10:120714766-120714788 TGGCCACAGCTTGGGGGTGGGGG + Intergenic
1075496247 10:122922106-122922128 TAGCCACTGCAAGGGGATAGGGG - Intergenic
1076181340 10:128411248-128411270 TGGCCACTGCAAGGGGTATGCGG + Intergenic
1076535645 10:131174995-131175017 TGGACTCTGGCTGGGGATGGAGG - Intronic
1076602546 10:131668230-131668252 AGGCCACTGCCAGGAGTTGCTGG + Intergenic
1076884411 10:133255215-133255237 CGTCCGCTGCCAGGGGCTGGGGG + Intergenic
1077220462 11:1413325-1413347 TGGCCCCTGCAAGGGGCTGCAGG - Intronic
1077245557 11:1535605-1535627 TGGCCACAGCCAGGGCAAGGGGG - Intergenic
1077273720 11:1693729-1693751 GGGCCAGTGCCTGGGGACGGAGG + Intergenic
1077294245 11:1817146-1817168 TGGCGAGTGCCAGGGGCTGGGGG + Intergenic
1077561439 11:3264197-3264219 TGGGCCCTGTCAGGGGGTGGGGG - Intergenic
1077567335 11:3310026-3310048 TGGGCCCTGTCAGGGGGTGGGGG - Intergenic
1077858751 11:6156751-6156773 TGGCCACTGCTGGGGGGTGGGGG - Intergenic
1078932020 11:15920192-15920214 TGGCCCCTGCCTGGAGATGGAGG + Intergenic
1079034708 11:17012110-17012132 TGGCCACTGCAGGGGGAGGCAGG - Intronic
1079124289 11:17707977-17707999 GGGCCAGGGCCAGGGGCTGGGGG - Intergenic
1080350987 11:31385887-31385909 TGGCCACTGCAGGGGGATGGGGG - Intronic
1080620081 11:33980049-33980071 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
1080707263 11:34707998-34708020 TGGCCACTGCCAGGGAGTGGAGG + Intergenic
1080823675 11:35830142-35830164 TGGCCACTGCCACAAGCTGGGGG - Intergenic
1081073834 11:38643211-38643233 GTGCCACTGCCAGGAGATTGGGG + Intergenic
1081710148 11:45211053-45211075 TGGCCACTGCCAGGAAAAGGAGG - Intronic
1083313249 11:61796869-61796891 TGGCCAGTGGGAGGTGATGGTGG + Exonic
1083369712 11:62168565-62168587 TGGTGATTGCCAGGGGACGGGGG - Intergenic
1084063199 11:66688890-66688912 TGGCCACTGGCAGGGCACAGTGG + Intronic
1084222171 11:67689160-67689182 TGGCAGTTGCCAGGGGATGGAGG + Intergenic
1084521034 11:69663013-69663035 GGTCCACAGCCTGGGGATGGGGG - Intronic
1084763977 11:71295458-71295480 CGGCTGCTGCCAGGGGATGGGGG + Intergenic
1085194867 11:74663008-74663030 AGGGCACTGCAAGGGGATGAGGG + Intronic
1085223322 11:74895202-74895224 TGGCTTCTGCCAGGGGATGGAGG - Intronic
1085444054 11:76589125-76589147 CAGCCACTGCCAGGGAACGGGGG - Intergenic
1085468801 11:76743613-76743635 AGGCCAGAGGCAGGGGATGGAGG - Intergenic
1085646455 11:78226645-78226667 TGGCCACTGTCATGGCATTGTGG + Exonic
1086902243 11:92381034-92381056 TGGTCATTGCCAGGGAATGAGGG - Intronic
1087032148 11:93716339-93716361 TGGCCACTGCCTGGAGATGAGGG + Intronic
1087052615 11:93901507-93901529 TGGGGCCTGCCAGGGGATGGGGG + Intergenic
1087554253 11:99694672-99694694 TGCTGACTGCCAGGGGGTGGGGG - Intronic
1087598541 11:100284119-100284141 GGGCCACTGCTGGGGAATGGAGG + Intronic
1087648118 11:100831666-100831688 TTGCCTCTGCCAGGGCATGGTGG + Intronic
1087950942 11:104219597-104219619 CAGTCACTGCCAGGAGATGGGGG + Intergenic
1088009709 11:104985624-104985646 TGGCCTCTGCCAGGGGATAGGGG - Intergenic
1088067281 11:105734910-105734932 TAGACACTGCCAGGTGCTGGGGG - Intronic
1088291141 11:108238967-108238989 TGGTAGCTGCCAGGGGATAGGGG - Intronic
1088411598 11:109540053-109540075 TGGCCACTGCCAGGGCATGGGGG + Intergenic
1088985068 11:114898750-114898772 CAGCCACTGCTAGGGGATGGGGG - Intergenic
1089494861 11:118902790-118902812 GGGGCACTGCCAGGGGCCGGGGG + Exonic
1090435963 11:126686503-126686525 TGGCCACTGAGCGGGGAGGGTGG + Intronic
1090501730 11:127267518-127267540 CAGCCACTGCCAGGAGATAGAGG - Intergenic
1090677045 11:129008079-129008101 GGGCCACTACCAGGGGATGGGGG + Intronic
1090724700 11:129514245-129514267 TGGGGCCTGTCAGGGGATGGTGG - Intergenic
1090760434 11:129832522-129832544 TGGTGATTGCCAGGGGTTGGGGG + Intronic
1091051109 11:132373557-132373579 TGGCCACTGCCAGGAGATGGGGG - Intergenic
1091450743 12:570668-570690 GGGCCAGGGCCAGGGGAGGGCGG - Intronic
1091779675 12:3205807-3205829 TGGCCTCTGCTGGGGGAAGGGGG + Intronic
1092140562 12:6180571-6180593 TGGGCACGGTCAGGGGAGGGTGG - Intergenic
1093022038 12:14212907-14212929 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1093208076 12:16275025-16275047 TACCCCCTGCCAGGTGATGGGGG + Intronic
1093420145 12:18965417-18965439 TGGCTGCTGTCAGGAGATGGGGG + Intergenic
1094070949 12:26412384-26412406 TGCCCACCCTCAGGGGATGGAGG - Intronic
1094419668 12:30257419-30257441 CAGCCACTGTCAGGGGATGGGGG - Intergenic
1094656009 12:32419922-32419944 TGGCCACTGCTGGGAGAAGGGGG + Intronic
1094837817 12:34330381-34330403 GGGCCACTCACAGGGGATGCTGG + Intergenic
1095163202 12:38941031-38941053 CAGCCACTGCCAGGGCTTGGAGG - Intergenic
1095181834 12:39154860-39154882 TGATCACTGCCATGGGATGAGGG + Intergenic
1095227389 12:39694380-39694402 TCGCCACTCCCAGGGAATGGAGG - Intronic
1095367326 12:41423298-41423320 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1095624984 12:44304140-44304162 TGGCCACTGCTGGGGGATGGGGG - Intronic
1095698661 12:45168006-45168028 TGAGCACTATCAGGGGATGGTGG + Intergenic
1096344080 12:50829536-50829558 AGGCCACTGCCAGGGGACTCTGG + Intergenic
1096622373 12:52872792-52872814 GGGCCATTCCCAGGGGCTGGCGG + Intergenic
1096656622 12:53096569-53096591 GGGACACTGCCTGGGGAAGGCGG + Intergenic
1097508500 12:60506880-60506902 AGGCCACTGCTGAGGGATGGGGG - Intergenic
1097724240 12:63056487-63056509 TGGTGATTGCCAGGGGCTGGAGG - Intergenic
1097899401 12:64857956-64857978 TGGCCACTGCCAGGGGATTGGGG + Intronic
1098696588 12:73565321-73565343 TGGCAGTTGCCAGGAGATGGTGG + Intergenic
1099562348 12:84193630-84193652 TAGCTGCGGCCAGGGGATGGTGG + Intergenic
1099826037 12:87779360-87779382 TGGACACTCCCAGGGTCTGGGGG - Intergenic
1100472873 12:94909221-94909243 TGGTCCCTTCCAGAGGATGGAGG - Intronic
1100904795 12:99285699-99285721 CAGTCACTGCCAGGGGATGAGGG - Intronic
1101026255 12:100609485-100609507 TGGCTGCTGCCAGGGGATGGGGG + Intronic
1101534004 12:105600755-105600777 TGACCAGAGCAAGGGGATGGTGG + Intergenic
1101609891 12:106281584-106281606 CAGCCATTGCCTGGGGATGGAGG + Intronic
1101838916 12:108313919-108313941 TGGCTGCTGCCTGGGGAGGGAGG - Intronic
1102703144 12:114857575-114857597 TGGGGACTGCCTGAGGATGGAGG - Intergenic
1103057844 12:117835669-117835691 TGGTCACTACCAGGGGCTAGGGG + Intronic
1103254892 12:119532573-119532595 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1103424074 12:120816193-120816215 TGCTCACTGCCAGGATATGGAGG - Intronic
1103436007 12:120925873-120925895 AGGCCCCTGCTGGGGGATGGGGG + Intergenic
1104150123 12:126074259-126074281 TGGCCACTGTGTGGGGATGATGG - Intergenic
1104192425 12:126495143-126495165 TTGCCAAGGGCAGGGGATGGGGG - Intergenic
1104969595 12:132525235-132525257 TGGGCACAGCCAGGGGACAGTGG + Intronic
1104974853 12:132547877-132547899 TGGCTGCTGCCAGGAGAGGGAGG - Intronic
1105343034 13:19545888-19545910 TGTCCATGGGCAGGGGATGGTGG + Intergenic
1105373339 13:19819969-19819991 AGGCCACAGCCAGGGGTTTGGGG + Intergenic
1105426373 13:20298309-20298331 GGGTCACTGCTGGGGGATGGTGG - Intergenic
1105449924 13:20490425-20490447 TGGTAGCTGCCAGGGGCTGGAGG + Intronic
1105462616 13:20606458-20606480 TTGCCACTGCCAGGTGAAGGTGG - Intronic
1105913518 13:24892535-24892557 TGGGAGCTGCCAGGGGCTGGGGG - Intronic
1106111170 13:26778403-26778425 TGGCGGTTGCCAGGGGCTGGTGG - Intergenic
1106350110 13:28921889-28921911 CAGCCACTGCCAGGGGATGGGGG + Intronic
1106357053 13:28992894-28992916 TGGTCATTGCCAGGGGCTGTGGG - Intronic
1106422222 13:29594466-29594488 TGACCCTTTCCAGGGGATGGGGG - Intronic
1107210746 13:37851777-37851799 TAGCCACTGCCATAGGATAGGGG - Intronic
1107808363 13:44175605-44175627 TGGCTGCTGCTGGGGGATGGTGG + Intergenic
1108431985 13:50362468-50362490 TGGCCATTGCTAGGGGTTTGGGG - Intronic
1108744678 13:53380002-53380024 TGGTGATTGCCAGGGGATGGGGG - Intergenic
1108854061 13:54771876-54771898 TGGGGCCTGCCAGGGGGTGGAGG - Intergenic
1109080176 13:57889092-57889114 TGGCAGTTGCCAGGGGGTGGGGG + Intergenic
1109961773 13:69640079-69640101 TGGCCACTGCTTGGGGATGGGGG + Intergenic
1110079054 13:71287529-71287551 TGGCCAATGCCACAGGATGAAGG + Intergenic
1111085933 13:83374720-83374742 TGGTTGCTGCCAGGGGATGGAGG + Intergenic
1111193493 13:84840402-84840424 TGGCCTCTGGGAGGGGATGCAGG - Intergenic
1111407381 13:87826307-87826329 TGGGGACTGTCAGGGGACGGGGG - Intergenic
1111448990 13:88390229-88390251 TGGCTGCTGCCAGGTGATAGGGG - Intergenic
1111639175 13:90946568-90946590 TGGCTACTGCCAGGGCATGGGGG - Intergenic
1112053931 13:95672075-95672097 CAGTCACTGCCAGGGGATAGGGG + Intergenic
1112436199 13:99392935-99392957 TGGCAAGTGCCTGGGGAGGGCGG - Intergenic
1112561120 13:100515048-100515070 TGGGCAGACCCAGGGGATGGAGG - Intronic
1112901621 13:104363905-104363927 ATGCTACTGCCAGGGGTTGGGGG + Intergenic
1112944516 13:104910805-104910827 TGACTTCTGCCAGGGGTTGGGGG + Intergenic
1113602422 13:111579609-111579631 TGGGGGCTGCCAGGGGCTGGGGG - Intergenic
1113744857 13:112737193-112737215 TGGGCACTCCTGGGGGATGGAGG + Intronic
1113778343 13:112961639-112961661 TGGCCACAGACATGGGAAGGAGG - Intronic
1113781836 13:112981656-112981678 TGGACCCTGCCAGGAGCTGGTGG - Intronic
1113889738 13:113729794-113729816 TGGCAACTGTCTCGGGATGGAGG - Intronic
1114563956 14:23614538-23614560 TGCCTGCTGACAGGGGATGGTGG + Intergenic
1114753266 14:25229496-25229518 TGGGACCTGTCAGGGGATGGGGG - Intergenic
1114761710 14:25323024-25323046 TGGCTGTTGCCAGGAGATGGGGG + Intergenic
1114820235 14:26009624-26009646 TGGCTGCTGCCACGGGATGAAGG - Intergenic
1115706606 14:36005809-36005831 TCGCCACTCTCAGGGGGTGGGGG - Intergenic
1115918233 14:38341978-38342000 TGGCCACTGCCAAGGAAAGGGGG - Intergenic
1115930072 14:38481782-38481804 TTGCCACCCCCAGGGTATGGGGG - Intergenic
1116583576 14:46674243-46674265 TGTCTGCTGCCAGGGGATGGGGG - Intergenic
1116765831 14:49069870-49069892 AGGCCACTGCCAGGGAATGCTGG - Intergenic
1117803079 14:59464848-59464870 TGGCAACTGCGCGGTGATGGGGG - Exonic
1117843151 14:59881563-59881585 TGGCCACTCCCAGGGAATTGGGG + Intergenic
1117989624 14:61420865-61420887 GTGCCACTGCCATGGGCTGGAGG + Intronic
1117995568 14:61474544-61474566 TGGGGCCTGGCAGGGGATGGGGG + Intronic
1118012022 14:61619178-61619200 TGGTGGTTGCCAGGGGATGGGGG + Intronic
1118084551 14:62399541-62399563 TGGCCACTGCCAGGGGACATGGG + Intergenic
1118096789 14:62546321-62546343 TGGCCACTGCCAGGGGTTGGGGG - Intergenic
1118776043 14:68974645-68974667 TGGCCATTGGCAGGAGCTGGTGG - Intronic
1118844284 14:69535023-69535045 TGGTGATTGCCAGGGGCTGGGGG - Intergenic
1119681557 14:76596098-76596120 TGGCCAGTGGCGGGGGGTGGGGG - Intergenic
1120275587 14:82369546-82369568 TGGCCACTGCCAGTGGAGGAAGG - Intergenic
1120697310 14:87658987-87659009 TGGCTACTGCCAGGAGATGAAGG - Intergenic
1121375815 14:93410096-93410118 TAGCCACTGCTAGGTGAGGGAGG - Intronic
1121668252 14:95688841-95688863 TGGTAGCTGCCAGGGGCTGGAGG + Intronic
1121743984 14:96273733-96273755 TTGCCACTACCAGGAGAGGGAGG - Intergenic
1122048056 14:99037395-99037417 TGGAGACTTCCAGGGGCTGGGGG + Intergenic
1122082084 14:99273405-99273427 TGGCCACAGCCTGGGGAATGGGG - Intergenic
1122126462 14:99581188-99581210 TGGCCTTTGCCAGGGTAGGGTGG - Intronic
1122183414 14:99971744-99971766 GGGCCGCCGCCGGGGGATGGGGG - Intronic
1122336815 14:100995811-100995833 TGGCGCCTGTCAGGGGAGGGTGG - Intergenic
1122838964 14:104445359-104445381 TGGCCTGGGCCAGGGGATGGGGG - Intergenic
1124586381 15:31013127-31013149 TGGCAACTGGCAGAGCATGGTGG - Intronic
1124964021 15:34419933-34419955 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
1124980635 15:34566164-34566186 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
1125483444 15:40095860-40095882 TTGCCACGGACAGGGGATGAAGG + Intronic
1125542926 15:40481550-40481572 TGGTAGTTGCCAGGGGATGGTGG - Intergenic
1125566209 15:40680374-40680396 TGGGTGCTGCCAGGGGATGGGGG + Intergenic
1126053469 15:44708091-44708113 TGGCCGCTGCCGGCGAATGGGGG + Intronic
1126464183 15:48945691-48945713 TAGTCTCTGCCAGGGGTTGGAGG + Intronic
1126560299 15:50035915-50035937 TGGGCACTGCCAGGTGCTTGTGG - Intronic
1126992472 15:54396261-54396283 GGGGCATTGCCTGGGGATGGTGG - Intronic
1127132514 15:55882311-55882333 CAGCCACTGCCAGGGGATGGAGG - Intronic
1127196307 15:56590286-56590308 CTGCCACTGCAAGGGGGTGGGGG - Intergenic
1128663471 15:69520999-69521021 TGGTGGTTGCCAGGGGATGGAGG + Intergenic
1128983940 15:72205917-72205939 TGGCCACTGCTCAGGGTTGGAGG - Intronic
1129925084 15:79356643-79356665 TGGAGAGTGTCAGGGGATGGGGG + Intronic
1130429282 15:83830590-83830612 TAGGCACTGGCAGGGGATGCAGG + Intronic
1130511661 15:84594762-84594784 CGGCCACTGCTGAGGGATGGGGG - Intergenic
1130601771 15:85280258-85280280 TGGCCAGAGCCAGAGGAAGGTGG - Intergenic
1131315251 15:91329819-91329841 TGGTCACTGCTGGGGGATAGGGG + Intergenic
1131396687 15:92091999-92092021 GGGCCAGTGACTGGGGATGGTGG - Intronic
1131470517 15:92692877-92692899 TGGCAACAGCAAGGGGGTGGAGG + Intronic
1131940383 15:97558395-97558417 GGGCCACAGCCAGAGAATGGAGG - Intergenic
1132379139 15:101353997-101354019 TGTCCTCTGCCCAGGGATGGTGG - Intronic
1132840991 16:1978477-1978499 TGGGCACAGCCTGGGGTTGGGGG + Intronic
1132995683 16:2821237-2821259 TGGCTGCTGCCAGGGGGAGGAGG + Intronic
1132998524 16:2836950-2836972 TGTCCACTGCCAGGAAATGTGGG + Intronic
1133310149 16:4840193-4840215 TGGGCACTGCAAGTGGATTGTGG - Intronic
1133780679 16:8936632-8936654 TGGCCTCTGCTGGGGGATGGGGG + Intronic
1134552876 16:15146108-15146130 CGGCCACTGTCACGAGATGGTGG + Intergenic
1134648246 16:15888234-15888256 TGGACCCTGCCGGGGGCTGGAGG - Intronic
1135461837 16:22651267-22651289 TGGGGCCTGCCAGGGGGTGGGGG - Intergenic
1135597055 16:23752910-23752932 AGGCCTCTGCCTGGGGCTGGAGG + Intergenic
1136381198 16:29896796-29896818 AGGCGACAGCAAGGGGATGGGGG - Intronic
1136545786 16:30953927-30953949 TGGCTCCAGCCAGGGGATGGGGG - Exonic
1137393066 16:48097574-48097596 ATGACACAGCCAGGGGATGGGGG + Intronic
1138506177 16:57479397-57479419 GGGGCCCTGCCAAGGGATGGGGG - Intronic
1138552807 16:57756641-57756663 TGGGCACAGCCAGGCCATGGAGG - Intronic
1138890852 16:61142519-61142541 TGGCCACTGCTGGGGAATGGAGG + Intergenic
1139484962 16:67250166-67250188 TGGACACTGCTAGGGGGTGAGGG + Intronic
1139919772 16:70452154-70452176 TGGCCACTGACTGGGCACGGTGG + Intergenic
1140778127 16:78269036-78269058 TGTACACTACCTGGGGATGGTGG - Intronic
1141138073 16:81479512-81479534 TGGTGGCTGCCAGGGGCTGGGGG - Intronic
1142687322 17:1585126-1585148 TAGCCACTGCCAAGGGGTGGAGG + Intronic
1143015606 17:3889765-3889787 TGGCCACTCCCAAGGAATGTGGG + Intronic
1144582696 17:16468538-16468560 TGGGTACTACCAGGGGCTGGGGG + Intronic
1144808770 17:17985284-17985306 TGGCCACTGCAAGGGGTTGGGGG - Intronic
1144836687 17:18160039-18160061 TGGACACAGTGAGGGGATGGTGG - Intronic
1144954392 17:19011787-19011809 GGGACACTGCCAGGGTAGGGGGG + Intronic
1145122412 17:20272547-20272569 TGGCTGCTGCCAGAGGCTGGGGG - Intronic
1146098978 17:29960189-29960211 AGGCCACTGCTGGGGGATGGAGG + Intronic
1146180544 17:30695449-30695471 TGGTGATTGCCAGGGGATGGGGG - Intergenic
1146242691 17:31244671-31244693 GGGCCACTGCCAGGAGGTGAAGG + Intronic
1146256420 17:31393480-31393502 TGGCCCCTGCCAGAGGTTGTTGG - Intronic
1146492405 17:33292334-33292356 AGGCCACTGCCAGGGGCTGCGGG - Exonic
1147059798 17:37866360-37866382 TGGCCACTGGCCAGGGATGCTGG + Intergenic
1147244586 17:39111633-39111655 AGGCCACTTGCAGGGGGTGGAGG - Intronic
1147627784 17:41910972-41910994 TGGCCTCTGGGAGGGGAAGGTGG - Intronic
1147703723 17:42411934-42411956 TGGGCAGTGACTGGGGATGGTGG + Intronic
1148409067 17:47448849-47448871 TGGCCACTGGCCAGGGATGCTGG + Intergenic
1149686653 17:58539441-58539463 TTTCCAAAGCCAGGGGATGGTGG - Intronic
1150887006 17:69098785-69098807 TGGTTATTTCCAGGGGATGGGGG + Intronic
1151235294 17:72715618-72715640 TGGCAGTTGCCAGGGGCTGGGGG + Intronic
1151778046 17:76221991-76222013 TGGTGATTGCCAGGGGATGGGGG + Intronic
1151887924 17:76934020-76934042 TGCCCACTTCCAGGGGATGCTGG + Intronic
1152095078 17:78268016-78268038 AGCCCACTTCCAGGGGGTGGTGG - Intergenic
1152102888 17:78313316-78313338 AGGCCACTGGCTGGGCATGGTGG + Intergenic
1152476551 17:80522135-80522157 TGGAAACTGCCAGGGCCTGGGGG - Intergenic
1152610036 17:81310896-81310918 TTGCCACAGCCACGGGAGGGAGG - Intergenic
1152642945 17:81456772-81456794 TGAGCTCTGCCTGGGGATGGGGG - Intronic
1152786001 17:82248460-82248482 TTGCCACTGGCCAGGGATGGAGG - Intronic
1153014737 18:573363-573385 TGGCCACTGCAAGGGCTGGGTGG + Intergenic
1153571263 18:6475716-6475738 TGGCCCCTGTCAGGGCATGTAGG + Intergenic
1153603027 18:6800697-6800719 TGGGACCTGTCAGGGGATGGGGG + Intronic
1153932364 18:9889474-9889496 TGGTGACTGCCAGAGGGTGGGGG - Intergenic
1154230449 18:12551923-12551945 TGGCCACTGCCAGGAGGTGGAGG - Intronic
1155087038 18:22468709-22468731 CAGCTGCTGCCAGGGGATGGGGG + Intergenic
1155597159 18:27501757-27501779 TGGCCGCTGCCAGAGGATGGAGG - Intergenic
1155694045 18:28662400-28662422 TGGGGCCTGTCAGGGGATGGTGG + Intergenic
1156055479 18:32998115-32998137 TGGCTGCTGCCAGAGGATAGTGG - Intronic
1156124516 18:33887572-33887594 TGGCGCCTGTCAGGGGGTGGGGG - Intronic
1156155707 18:34299967-34299989 CAGCTGCTGCCAGGGGATGGGGG - Intergenic
1156373394 18:36491018-36491040 CAGACACTGCCAGGGGCTGGAGG + Intronic
1156733869 18:40229222-40229244 TGGCGATTGCCAGGGGGTAGTGG - Intergenic
1156968992 18:43132384-43132406 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1157351402 18:46890162-46890184 TGGTAACTGCCAGGGGCTAGTGG + Intronic
1157530175 18:48413749-48413771 TGGCCCCTGGAAGGGAATGGTGG - Intergenic
1158478532 18:57802072-57802094 TGGTCCCTGCCGGGGGTTGGTGG - Intronic
1158762230 18:60403520-60403542 CCACCACTGCCAAGGGATGGAGG - Intergenic
1158800903 18:60907550-60907572 CAGCGACTGCCCGGGGATGGAGG + Intergenic
1158819096 18:61137607-61137629 TGGTAATTGCCAGGGGCTGGGGG - Intergenic
1158934831 18:62354772-62354794 TGGCCATGGCCAGGGGTTGCTGG + Intronic
1158976308 18:62714994-62715016 TGGCCACGGCCAGCTGCTGGCGG + Intergenic
1159285050 18:66337611-66337633 CGACCACTGCCAGGGCATGGTGG + Intergenic
1161162487 19:2768924-2768946 TGGCCGCTGCCCGGGGAGAGGGG + Intronic
1161171417 19:2814142-2814164 TGCCCACAGCCAGGGGAGTGGGG - Exonic
1162097350 19:8318433-8318455 TGGCCTCTGACTGGGCATGGTGG - Intronic
1162525439 19:11203795-11203817 TGGTCACTGCAGGGGGGTGGCGG - Intronic
1162957476 19:14107281-14107303 GGGACACAGCCAGGGGCTGGGGG + Intronic
1162978048 19:14220091-14220113 TGGTGGTTGCCAGGGGATGGGGG + Intergenic
1163081313 19:14944890-14944912 TGGCGACTGTCTGGGGCTGGTGG - Intergenic
1163381442 19:16971568-16971590 TGGTGACTGCCAGGGGCTGAGGG + Intronic
1163692688 19:18745924-18745946 TGTCCACTGACAGGGGCCGGCGG - Exonic
1163699015 19:18777843-18777865 TGACCACGGGCTGGGGATGGCGG - Exonic
1163701865 19:18790181-18790203 TGGCCACGCCCCGGGGCTGGAGG + Intronic
1163718674 19:18887329-18887351 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
1164120812 19:22263004-22263026 TGCCCACAGCCAGGGAAAGGCGG - Intergenic
1164538887 19:29107454-29107476 TGGGGGCTGCCAGGGGATGCGGG + Intergenic
1165170385 19:33888039-33888061 AGGCGACGGCCAGGGGATGGCGG - Intergenic
1165351150 19:35276741-35276763 TGGCCTCTGCATGGGAATGGGGG - Intronic
1165362393 19:35344953-35344975 GGGCCTCTGCCAAGGGATAGAGG - Intronic
1165468542 19:35989655-35989677 TGGGCACTGCCAGGGGGCTGGGG + Intergenic
1165645256 19:37430828-37430850 TGGCCACTGCCGGAGAATAGGGG - Intronic
1165866736 19:38944028-38944050 TGGCGACTGCCAGGGGCTGGGGG - Intronic
1167291280 19:48626341-48626363 CTGCCACTGCCCGGGGATGGGGG + Exonic
1167517743 19:49932954-49932976 GGGCGAGTGCCAGGGGCTGGAGG + Exonic
1167665168 19:50819441-50819463 TGCCCACTCCCAGAGGAAGGTGG + Intronic
1168267497 19:55230679-55230701 TGGGCACTGTCAGGGGAGAGAGG + Exonic
1168282199 19:55311838-55311860 TTCCCATTACCAGGGGATGGGGG - Intronic
925269296 2:2590982-2591004 AGGCCACTGCCAGGAGATGGGGG - Intergenic
925831858 2:7903742-7903764 GGGGGACTGCCAGGAGATGGAGG - Intergenic
925918207 2:8622486-8622508 TGGGGGCTGCAAGGGGATGGGGG - Intergenic
926370332 2:12172256-12172278 TTTCCAATGCCAGTGGATGGTGG - Intergenic
927222119 2:20722258-20722280 TGGCTACTGGCGGGGGAAGGTGG + Intronic
927419583 2:22916226-22916248 AGGCCACTCCCTGGGGATGTGGG - Intergenic
927447768 2:23180341-23180363 TGGTGGCTGCCAGGGGATGAAGG + Intergenic
927510763 2:23642597-23642619 TGGACACGGCCAGGGGCTGAGGG - Exonic
927515951 2:23671800-23671822 TGCCCACTGGCTGGGGATGGAGG + Intronic
927698372 2:25252315-25252337 GGGCCACTGGGAGGGGAGGGGGG + Intronic
927975636 2:27336163-27336185 TGGACACTGCCATGGGAGGGTGG - Intronic
928055085 2:28044516-28044538 TGGCCCTTGCCCGGGCATGGTGG - Intronic
928073554 2:28242019-28242041 TGGCTACTGTGAGGGCATGGAGG - Intronic
928398328 2:30960175-30960197 CAGCCTCTGCCAGAGGATGGTGG + Intronic
928565799 2:32547374-32547396 TGGTAATTGCCAGGGGCTGGGGG - Intronic
928944635 2:36761347-36761369 TGTCCACTGGCCTGGGATGGGGG + Intronic
929141742 2:38672483-38672505 TGGCCTGTGCCTAGGGATGGAGG + Intronic
929206779 2:39305032-39305054 TGTTCGCTGCCAGGGGCTGGAGG + Intronic
929779181 2:44946823-44946845 GGGCCCCGGCCAGGGCATGGAGG - Intergenic
930041659 2:47129640-47129662 TGGCTGCTGCCAGGGGATGGGGG + Intronic
930469150 2:51791786-51791808 TGACTACTGCCAGGAGATGAGGG - Intergenic
930778145 2:55195977-55195999 TGGCCACTGCCAAAGGATGGGGG - Intronic
930878421 2:56245407-56245429 TGGCCTCTGCCAGGGGATGGAGG + Intronic
931012302 2:57930423-57930445 CAGCCACTGCCAGGGGATTGGGG + Intronic
931086067 2:58831768-58831790 CAGCCACTGCCAGAGGATGGGGG + Intergenic
931309118 2:61061905-61061927 TGGCAGCTACCAGGAGATGGGGG + Intergenic
931407023 2:61988995-61989017 TGGCTGCTGCTAGCGGATGGGGG + Intronic
931582888 2:63796501-63796523 CAGCCACTGCCAGGGGATGGGGG - Intronic
932313971 2:70767634-70767656 TGGCCCCTGCTTGGGGATGGTGG - Intronic
932412262 2:71554516-71554538 TGTCCAGTGCAAGGAGATGGGGG + Intronic
932517439 2:72367679-72367701 CAACCACTGCCAGGGGATGGGGG - Intronic
932630435 2:73337970-73337992 TGGTCGTTGCCAGGGGTTGGTGG + Intergenic
932722504 2:74148040-74148062 CAGCCAGGGCCAGGGGATGGCGG - Intergenic
933507637 2:83199156-83199178 CGGGCCCTGCCAGGGGGTGGGGG - Intergenic
933539174 2:83617073-83617095 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
933933045 2:87174553-87174575 TGGCGGCTGCCAGAGGCTGGTGG - Intergenic
934039360 2:88115280-88115302 GGGCCACTGCCAAGGAATGTGGG - Intergenic
934650133 2:96085880-96085902 GGGCCAGGGCCAAGGGATGGAGG + Intergenic
934983111 2:98863884-98863906 TGGTGACTGCCAGGGGCTGAGGG + Intronic
935212615 2:100951654-100951676 TGGTGAGTGCCAGGGGCTGGAGG + Intronic
935265425 2:101389538-101389560 TGGTTGCTGCCAGGGGCTGGGGG - Intergenic
935835686 2:107050687-107050709 TTGCCACTACCAGGGGATGTGGG + Intergenic
936117412 2:109713105-109713127 TGGCCAGTGCAAGAGGAGGGAGG - Intergenic
936386806 2:112037861-112037883 TGGTGACTGCCAGGGGCTGTGGG + Intergenic
936492890 2:112989133-112989155 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
936511419 2:113150471-113150493 TGGCTGCTGCTGGGGGATGGGGG + Intergenic
936726048 2:115317204-115317226 TGGTGATTGCCAGGGGATGAGGG - Intronic
936889893 2:117356969-117356991 TGGTGGTTGCCAGGGGATGGGGG - Intergenic
936940514 2:117879354-117879376 TAGCCACAGCCAGGGGATGCCGG + Intergenic
937210335 2:120264768-120264790 TGGCGGCTGCCAGGGGGTGGGGG - Intronic
937258894 2:120573004-120573026 GGGCTCCTGCCAGGGGCTGGGGG - Intergenic
938801027 2:134763453-134763475 TTCCCAATGCTAGGGGATGGGGG - Intergenic
938889358 2:135687244-135687266 TGGTCATTGCCAGGGGCTGCAGG + Intronic
939708038 2:145479238-145479260 TGGCTGCTGCCAGGGGATAGGGG + Intergenic
939964472 2:148596921-148596943 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
941138587 2:161747409-161747431 ACTGCACTGCCAGGGGATGGGGG + Intronic
941811225 2:169757549-169757571 TGCCCAGTGACTGGGGATGGGGG + Intronic
941874426 2:170418689-170418711 GGCCCAGGGCCAGGGGATGGAGG - Intronic
942734856 2:179097649-179097671 TTGCCACTTTCAGGGGATAGAGG + Intergenic
942778609 2:179614074-179614096 CGGCTGCTGCCAAGGGATGGAGG + Intronic
942881785 2:180870608-180870630 TGGCTGCTACCAGGGGATGAGGG - Intergenic
943067748 2:183106310-183106332 CGGCCACTGCCAAGGGATGGGGG + Intergenic
943302606 2:186222943-186222965 TAGCCACTGCTGGGGGATAGGGG - Intergenic
943715474 2:191147484-191147506 TGGTGATTGCCAGGGGTTGGGGG + Intronic
943844969 2:192634414-192634436 TGGCCACTGCTGGAGGATGGGGG - Intergenic
944078466 2:195758683-195758705 CTGCCACTGCCGGGTGATGGAGG - Intronic
944414905 2:199470977-199470999 AGGCTACAGCCAGGGGCTGGGGG + Intronic
944530997 2:200667742-200667764 TGGGGACTGCCAGGGGTGGGTGG + Intronic
944550136 2:200838261-200838283 TGGCCACTACTGGGGGATGGGGG - Intergenic
944760230 2:202807255-202807277 TGGCCACTGCCAAGAGATGGTGG - Intronic
945711855 2:213306810-213306832 TGGCCACTGCCAGGGGATGGGGG + Intronic
945771147 2:214044672-214044694 TGGCCTCTGCCAGGGGATGAAGG - Intronic
945803857 2:214465988-214466010 AGGTCACTGCCAGAGGATGTGGG + Intronic
947380809 2:229543691-229543713 AAGCCACTGGCAGGGGGTGGAGG - Intronic
947505360 2:230704298-230704320 TGGTTGCTGCCAGGGGATGGGGG + Intergenic
947525760 2:230875816-230875838 TGGCCAGGGCCTGGGGGTGGGGG + Intronic
947706677 2:232282010-232282032 GGCTCACTGTCAGGGGATGGAGG - Intronic
947812552 2:233013505-233013527 TGGCCAATGCTTGGGGTTGGTGG - Intronic
948178198 2:235960352-235960374 TGGCCACTGCGGGGAGAAGGAGG - Intronic
948224150 2:236295759-236295781 TGGTGATTGCCAGGGGCTGGGGG - Intergenic
948713568 2:239841877-239841899 TGTGCACAGCCAGGTGATGGTGG - Intergenic
948856811 2:240734104-240734126 TGGCCACGGCCAGAGGAGCGTGG + Intronic
1169915677 20:10680848-10680870 TGGCGATTGCCAGGGCCTGGGGG - Intergenic
1170709373 20:18776184-18776206 TGGCTACTGCCAGGGGATAGAGG + Intergenic
1170864234 20:20138560-20138582 TGGCTACTGCCAGGGGAATGGGG + Intronic
1171020235 20:21578157-21578179 TGGGCAGTGCCAGGGTCTGGTGG + Intergenic
1172607240 20:36222271-36222293 TGGCCAAAGCCAGGGCCTGGTGG - Exonic
1172883557 20:38217064-38217086 TGCCCCCAGCCAGGGGATGGGGG + Intronic
1172883600 20:38217199-38217221 TAGCCCCAGCCAGGGGATCGGGG + Intronic
1172944552 20:38677073-38677095 TGTCCAGTGACAGGGGATGGAGG - Intergenic
1174033452 20:47650231-47650253 TGGCTATTGCAAGGGGAGGGAGG - Intronic
1174035680 20:47666958-47666980 TGGTGATTGCCAGGGGCTGGGGG + Intronic
1174086987 20:48016437-48016459 AGGCAGCTGCCAGGGGCTGGTGG + Intergenic
1174103205 20:48143023-48143045 TGGCTACTGCTTGGGGAAGGAGG + Intergenic
1174165095 20:48578654-48578676 TGGCCACAGCCAAGGAATGCCGG - Intergenic
1174356008 20:49998293-49998315 TGGCCACGGCCCCGTGATGGTGG + Intergenic
1175273860 20:57754207-57754229 GGGTCATTGCCAGGGAATGGTGG - Intergenic
1175348009 20:58296596-58296618 TGTGCAGAGCCAGGGGATGGGGG - Intergenic
1175589778 20:60179857-60179879 TGGTGGCTGCCAGGGGCTGGGGG - Intergenic
1175632283 20:60551264-60551286 CAGCCACTGCTGGGGGATGGAGG + Intergenic
1175903517 20:62369073-62369095 TGGCCAGTGCCGGGGGACAGCGG - Intergenic
1175955210 20:62605562-62605584 TGGGCAGTGCCAGCGGATGCAGG - Intergenic
1175977634 20:62719595-62719617 TGGCGGTTGCCAGGGGCTGGGGG - Intronic
1176123360 20:63464196-63464218 TGGCCCCAGACAGGGGATGCTGG - Intronic
1176152378 20:63598600-63598622 TGGGCACGGCCCGGGGGTGGAGG - Intronic
1176308069 21:5134743-5134765 TCCCCACTGCGAGAGGATGGGGG + Intronic
1176698123 21:10005995-10006017 TGGGGCCTGCCAGGGGGTGGGGG - Intergenic
1177137197 21:17318192-17318214 TGATCACTGCTGGGGGATGGGGG - Intergenic
1177494710 21:21873565-21873587 TGGCCACTGCTGGCGGATGAGGG + Intergenic
1177504023 21:21998136-21998158 TGGCCACTGCCAGGGGATGTGGG + Intergenic
1178081535 21:29071671-29071693 TGGCTATTGGCAGGGGTTGGTGG - Intronic
1179311554 21:40200315-40200337 TGGTGACTGCCAGGGCCTGGGGG - Intronic
1179536983 21:42059205-42059227 AGGCCACAGACAGGGGATCGGGG - Intergenic
1179540655 21:42081494-42081516 TGGCCAGCTCCAAGGGATGGAGG + Intronic
1179848991 21:44127289-44127311 TCCCCACTGCGAGAGGATGGGGG - Intronic
1182088056 22:27575016-27575038 CGGCCACTGCCTGGGGATGGGGG - Intergenic
1182201715 22:28578689-28578711 TGGGCACTGCCAGGGGATAAGGG - Intronic
1182305201 22:29363136-29363158 TGTCCCCTGCCAGGGTAGGGAGG - Intronic
1182312512 22:29419290-29419312 TGTCCCCTGCCAGGGTAGGGAGG - Intronic
1183303651 22:37070643-37070665 AGGCCACAGTCTGGGGATGGGGG + Exonic
1184289784 22:43492509-43492531 TGGGCACTGCCTGTGGGTGGGGG + Intronic
1184987472 22:48145541-48145563 AGGCACCTGCTAGGGGATGGAGG - Intergenic
1185028053 22:48426724-48426746 TGGCCATCTCCAGGGGGTGGGGG + Intergenic
1185043129 22:48515818-48515840 TGGCATTGGCCAGGGGATGGGGG + Intronic
1185232446 22:49690967-49690989 TGGCCACTGCCAGGGCTTGGGGG + Intergenic
1185267551 22:49912201-49912223 TGGCCTGTGGCAGGGGCTGGGGG + Intronic
1185276378 22:49951751-49951773 TGGGCACAGCCAGGGGTGGGAGG - Intergenic
949353253 3:3147999-3148021 TGGCCACTTACAGGAAATGGAGG - Exonic
949579259 3:5370811-5370833 TGGTGGTTGCCAGGGGATGGAGG - Intergenic
949949429 3:9216988-9217010 TGGTGATTGCCAGGGAATGGGGG + Intronic
950220200 3:11189642-11189664 TGGCCACTGGCTGGGCGTGGTGG + Intronic
950449398 3:13057230-13057252 AAGACACAGCCAGGGGATGGAGG + Intronic
950554361 3:13686240-13686262 AGACCAGTGCCAGGGGAGGGCGG + Intergenic
950561425 3:13730551-13730573 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
950908675 3:16564133-16564155 TGGCAGTTGCCAGGGAATGGGGG + Intergenic
951064242 3:18245910-18245932 TGGTGGTTGCCAGGGGATGGAGG - Intronic
951555736 3:23918604-23918626 TGAATACTGCCTGGGGATGGTGG + Intronic
952027319 3:29099118-29099140 TGCCCACTCCCAGGGGAAGAGGG - Intergenic
952342614 3:32458502-32458524 TTGCCAGGGCCAGGGGAAGGGGG + Intronic
953226417 3:41025683-41025705 TGGACACAGACTGGGGATGGAGG + Intergenic
953477750 3:43220480-43220502 TGGTGACCTCCAGGGGATGGAGG - Intergenic
953878603 3:46680249-46680271 TGGCCAGGGCCAGGGGAGGTGGG + Intronic
954289427 3:49641958-49641980 GAGGCACTGCCAGGGGGTGGCGG + Intronic
954703198 3:52463124-52463146 TAGTGACTGCCAGGGGCTGGGGG - Intronic
955207991 3:56914821-56914843 TGGTGGTTGCCAGGGGATGGGGG + Intronic
956034605 3:65077510-65077532 TGACGGTTGCCAGGGGATGGGGG + Intergenic
956157971 3:66318141-66318163 TGTCCACTCCCATGGGAAGGGGG - Intronic
956309475 3:67863362-67863384 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
957018983 3:75102169-75102191 TAGCCACTGCCAGGGGATAAAGG + Intergenic
957407077 3:79785317-79785339 TGGACACAGGAAGGGGATGGGGG + Intergenic
959306821 3:104677923-104677945 TGGCTGCTGCCAGGGGATAGAGG - Intergenic
959409163 3:105998456-105998478 TGGTCACTGCCAGGGCATAGAGG + Intergenic
959443882 3:106413075-106413097 CGGCTGCTGCCAGGGGATAGGGG + Intergenic
959806725 3:110562908-110562930 CAGCCAGTGCCAGGGAATGGGGG + Intergenic
959868588 3:111300409-111300431 TGGCTGCTACCAAGGGATGGGGG + Intronic
960207820 3:114924536-114924558 TGATGATTGCCAGGGGATGGTGG + Intronic
960222135 3:115125549-115125571 TGGTGACTACCAGGAGATGGTGG + Intronic
961445149 3:126976992-126977014 AGGCCACAGCCAGGTGGTGGTGG - Intergenic
961538663 3:127585896-127585918 TGGCAACTGCTAGGGAATGGAGG + Intronic
961673227 3:128549613-128549635 TGGCACATGCCAGGGCATGGGGG + Intergenic
961867957 3:129967790-129967812 TGACGGGTGCCAGGGGATGGAGG - Intergenic
962015027 3:131430890-131430912 TGGCCACTGCCAGGGGATGGAGG - Intergenic
962078836 3:132115250-132115272 TGGCCACTGCCAGGAGATGAGGG + Intronic
964151549 3:153531696-153531718 TGGCCACTGCCAGGGAGTTGGGG - Intergenic
964172826 3:153790933-153790955 TGGGGCCTGCCAGGGGGTGGGGG - Intergenic
965099320 3:164276745-164276767 TGGCCACTGCCTGCGGACTGGGG - Intergenic
965145123 3:164890871-164890893 AGGCCACTGCCAAGGGATGGGGG + Intergenic
966348433 3:179004136-179004158 CTGCCACTGCTGGGGGATGGAGG - Intergenic
966454125 3:180095120-180095142 CGGCCACTGCCGGGGGATGGGGG + Intergenic
967281613 3:187828874-187828896 TGGCCTCTGCCAGTGACTGGGGG + Intergenic
968067063 3:195764572-195764594 TGGAAACTGCCATGGGACGGGGG + Intronic
968562970 4:1294779-1294801 TGGACAGTGGCAGGGGACGGGGG + Intronic
968847865 4:3056923-3056945 TGGTAATTGCCAGGGGCTGGTGG - Intergenic
968888975 4:3356542-3356564 TGGTGGCTGCCAGGGGTTGGGGG - Intronic
969215993 4:5722999-5723021 TGGTCTCTGCCAGGGGATGAAGG - Intronic
969280476 4:6167307-6167329 GGGCCACTGTCAGGGGGAGGAGG - Intronic
969514598 4:7639329-7639351 TGGCCACAGCCAGGAGATACTGG - Intronic
969689323 4:8695466-8695488 CGGCCACTCCCAGAGGAAGGAGG + Intergenic
971447880 4:26771634-26771656 TGGCTGTTGCCAGGGGATGGGGG + Intergenic
972104917 4:35471599-35471621 TGGGGACTGTCAGGGGGTGGGGG + Intergenic
972176979 4:36420090-36420112 TGAGCACTGACAGGGGGTGGAGG - Intergenic
972271211 4:37512088-37512110 TGGCCACTGCTGAAGGATGGGGG + Intronic
972368422 4:38397480-38397502 TTTCCACTGCTAGGAGATGGTGG + Intergenic
972542965 4:40056044-40056066 AGGCGACTGCCACGGGGTGGAGG - Intergenic
973705088 4:53573215-53573237 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
973763122 4:54139219-54139241 TGGCCGCTGCTGGGGGATGAAGG - Intronic
973763190 4:54139618-54139640 TGGCCACTGCTGGGGGGTGAGGG - Intronic
973919158 4:55667142-55667164 TAGCGATTGCCAGGGGCTGGGGG - Intergenic
974081026 4:57212610-57212632 TGGTCATTGCCAGGGGCTGAGGG + Intergenic
975175076 4:71279245-71279267 TGGCAGCTGCCAAGGGCTGGTGG - Intronic
975629548 4:76386733-76386755 CAGCCACTGCTGGGGGATGGTGG - Intronic
976436566 4:85025207-85025229 TGGTAGCTGCCAGGGGTTGGGGG - Intergenic
977397171 4:96485134-96485156 TGGCTTCTGCTAGAGGATGGGGG + Intergenic
977722834 4:100260969-100260991 TGGCGCCTGTCAGGGGATCGGGG + Intergenic
977758065 4:100697193-100697215 AAGCCACAGGCAGGGGATGGGGG + Intronic
978228316 4:106365972-106365994 TGACCACAGCTAGGAGATGGAGG - Intergenic
978287695 4:107098276-107098298 TGACTGCTGCCAGGGGATGGTGG - Intronic
979011286 4:115373021-115373043 TGGGTTCTGCCAGGGGAAGGAGG + Intergenic
979099909 4:116600131-116600153 TTGCCATTGCCAGGAGATGGGGG + Intergenic
979213409 4:118133425-118133447 TGGCCACTGCCGGGAGATAGGGG + Intronic
979470346 4:121088787-121088809 TGGTCTTTGCCAGGGGTTGGGGG + Intergenic
980760072 4:137221376-137221398 TGGGGATTGCCAGGGGATAGGGG + Intergenic
981243742 4:142509380-142509402 TGGGGCCTGTCAGGGGATGGGGG - Intronic
981394584 4:144233198-144233220 AGGCCACAGCCAGGGTATGGGGG - Intergenic
981864871 4:149405397-149405419 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
982507111 4:156233333-156233355 TGGGTCCTGCCAGGGGGTGGGGG - Intergenic
983338194 4:166422077-166422099 TGGTCACTGCCAGGGTAGTGGGG + Intergenic
983388798 4:167102513-167102535 AGGCCACTGCTTGAGGATGGGGG - Intronic
983458798 4:168000763-168000785 TGGTGATTGCCAGGTGATGGGGG + Intergenic
983492994 4:168411359-168411381 TGGCCACTGCTGGAGGATGTGGG - Intronic
983725044 4:170910847-170910869 TGGGCCCTGTCAGGGGATGGGGG - Intergenic
983898947 4:173112989-173113011 TGGCCACACCGAGGAGATGGAGG - Intergenic
984292656 4:177814795-177814817 TGGCTGCTGCCAGGGGTTAGGGG - Intronic
985658908 5:1146024-1146046 CGGGGACTGCCAGGGGCTGGGGG - Intergenic
986085212 5:4438002-4438024 AGGTCACTGCCAGGAGATAGTGG + Intergenic
986312455 5:6562708-6562730 TGGCAACCCCCAGGGGCTGGGGG + Intergenic
986631317 5:9776303-9776325 TGCCCACTGCCAGGTAATAGGGG + Intergenic
988082610 5:26432984-26433006 AGGCCACTGCTGGGGGATGTGGG - Intergenic
988608656 5:32704214-32704236 TGGCTGCTGCTGGGGGATGGGGG + Intronic
988956473 5:36324742-36324764 CCATCACTGCCAGGGGATGGAGG + Intergenic
989063262 5:37431724-37431746 TGGTTGCTGCCAGGGGCTGGGGG - Intronic
989215464 5:38900278-38900300 GGGCTGCTGCCAGGGAATGGGGG + Intronic
989502355 5:42182749-42182771 TGGCTGCTGCCAGGGGATGAGGG - Intergenic
989751262 5:44896510-44896532 TGGTGGTTGCCAGGGGATGGGGG - Intergenic
990324604 5:54662152-54662174 TGGGCAGTGCAAGGAGATGGAGG - Intergenic
990620971 5:57557956-57557978 TGGCCACAGCCAGGAGGTTGTGG - Intergenic
991209260 5:64085267-64085289 TAGCCAGTGCCAGGGGATGCGGG + Intergenic
991237565 5:64417442-64417464 TGGCTGCTGCCAGGAAATGGGGG - Intergenic
993000436 5:82375389-82375411 TGGCAGCTGCCATGGAATGGAGG + Intronic
993298676 5:86178808-86178830 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
993763810 5:91830787-91830809 TGGCAACTGCCAAGGGAGAGAGG + Intergenic
994028460 5:95113418-95113440 CAGCCACTGCTTGGGGATGGGGG - Intronic
994217988 5:97159972-97159994 TGGCCGCTGCCAAGGGATGGGGG + Intronic
994343735 5:98661784-98661806 TGGCTGCTACTAGGGGATGGGGG - Intergenic
994853906 5:105091611-105091633 TGGCTACTTCCAGGGGCTGCTGG - Intergenic
994869909 5:105334561-105334583 CAGCCACTGCCATGGGATTGGGG + Intergenic
995049568 5:107687487-107687509 TGGCCACTGCTGGGTGATGGTGG - Intergenic
995247942 5:109957029-109957051 TGACCAGTGGCAGGGGATGCTGG + Intergenic
995770494 5:115664496-115664518 TGGCCACTGCCAACAGATGTCGG - Intergenic
996294466 5:121895227-121895249 TGGGTCCTGTCAGGGGATGGGGG + Intergenic
996960169 5:129237485-129237507 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
996961624 5:129256406-129256428 AGGCTTCTGCCAGTGGATGGGGG + Intergenic
997059730 5:130487443-130487465 TTGCCTCTGCCAGGAGATGGGGG - Intergenic
997082598 5:130758287-130758309 TGGGGCCTGTCAGGGGATGGAGG + Intergenic
997531109 5:134581745-134581767 TGGCTGCTGCGAGGGGAGGGGGG + Exonic
998528554 5:142864276-142864298 TGTCCACTGCCTGGGGAGGCAGG - Intronic
998732836 5:145100682-145100704 AGCTCACAGCCAGGGGATGGTGG + Intergenic
999123111 5:149225323-149225345 TGGTGACTGCCAGGGGTTCGGGG - Intronic
999142476 5:149371598-149371620 TGGACACTGCCAGGTGCTGGAGG + Intronic
999849615 5:155523957-155523979 TGGCCACTGCTGGGGGAAAGGGG + Intergenic
999886949 5:155935000-155935022 TGTCCAATGCTTGGGGATGGTGG + Intronic
1000052630 5:157575746-157575768 TGCCCACTGCCCGGCGGTGGAGG + Exonic
1000052669 5:157575852-157575874 GGGCCTCCGCCAGGGGATGGAGG + Intergenic
1000053048 5:157578481-157578503 TGGCCACTGCCTGGTGCTGTGGG - Intergenic
1000328401 5:160188855-160188877 GGGCCACCCCAAGGGGATGGGGG - Intronic
1000478788 5:161745031-161745053 TTGCCTCTGTCAGGGGATGCAGG + Intergenic
1000655520 5:163873940-163873962 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1000751280 5:165099006-165099028 TGGTCACTGCTAGGGGTTGAGGG - Intergenic
1001266669 5:170278928-170278950 GGACCACTGCCAGGGTCTGGTGG + Intronic
1001635045 5:173203801-173203823 TGGTGACTTCCAGGGGCTGGAGG - Intergenic
1001687065 5:173601636-173601658 CGGTCACTGCCAGTGGCTGGAGG + Intergenic
1001959625 5:175872259-175872281 TAGACATTGACAGGGGATGGGGG + Intronic
1002181339 5:177432635-177432657 TGCCCACTTCCAGGGGAGAGGGG - Intronic
1002571422 5:180141537-180141559 CGGCGAGTGCCAGGGGCTGGGGG + Intronic
1002791023 6:437606-437628 TGGTGTCTGCCAGGGGCTGGTGG - Intergenic
1003313272 6:4987468-4987490 TGGCCAATGGCTGGGGTTGGGGG + Intergenic
1003531833 6:6943585-6943607 TGGGGGCTGCCAGGGGCTGGGGG + Intergenic
1003549339 6:7088240-7088262 TGGCAGCTGCCAGGGGCTGGGGG - Intergenic
1004395681 6:15245226-15245248 TGGCGGCCGCCAGGGGAGGGGGG + Intergenic
1005037542 6:21570409-21570431 TGGCCACTGCTGGGGGATGGGGG + Intergenic
1005157200 6:22820093-22820115 TGGCTGCTGGCAGGGAATGGGGG + Intergenic
1005993960 6:30920713-30920735 TGTCCGCTGCCAGGAAATGGGGG + Exonic
1006046031 6:31299262-31299284 TGGGGTCTGTCAGGGGATGGGGG - Intronic
1006067506 6:31472666-31472688 TGGCCTCTGCCATGGTATAGAGG - Intergenic
1006383204 6:33712932-33712954 TGGTCGTTGCCAGGGGCTGGGGG - Intergenic
1006677516 6:35775118-35775140 TGGCCTCTGGCTGGGCATGGTGG - Intergenic
1007634789 6:43292864-43292886 AGGACATTCCCAGGGGATGGGGG + Intergenic
1007737389 6:43990202-43990224 TGGCCACAGTGAGGGCATGGGGG + Intergenic
1007929939 6:45681305-45681327 TGGTGGTTGCCAGGGGATGGGGG + Intergenic
1009039474 6:58159159-58159181 TGGCCACTGCCAAGGAATAGGGG + Intergenic
1009215367 6:60913999-60914021 TGGCCACTGCCAAGGAATGGGGG + Intergenic
1009375386 6:62961769-62961791 TGGCCACTGCCAGGGGATGGAGG + Intergenic
1009684357 6:66936951-66936973 TGGCCAGTGCCAGCAGAGGGTGG - Intergenic
1009742691 6:67767758-67767780 TGGGCCCTGTCAGGGGATGGGGG + Intergenic
1009744723 6:67798242-67798264 TGGCCATTGCCAGGGGAAGGGGG - Intergenic
1009781658 6:68279617-68279639 TGACCATTGCCAGGGGATCAGGG - Intergenic
1009961536 6:70528839-70528861 TGGGGACTGTCAGGGGGTGGGGG - Intronic
1010469732 6:76212798-76212820 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1010503879 6:76632560-76632582 TGGTGGCTGCTAGGGGATGGGGG + Intergenic
1010942270 6:81932798-81932820 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1010954108 6:82070783-82070805 TGGCAGCTGGCAGGGGAAGGAGG + Intergenic
1011291295 6:85779859-85779881 TGGCTGCTGTCATGGGATGGGGG + Intergenic
1011322941 6:86116778-86116800 TGGTCACTGCCAGAGGATGATGG + Intergenic
1011675712 6:89731597-89731619 TGGGGCCTGTCAGGGGATGGGGG + Intronic
1012113235 6:95261980-95262002 TGGCCCCTGCCAGGAAGTGGGGG + Intergenic
1012507396 6:99963484-99963506 TGGTGATTGCCAGGGGCTGGAGG + Intronic
1012624864 6:101393240-101393262 TCTCCACTGCCAGGGCTTGGAGG - Intergenic
1013152539 6:107459934-107459956 CTGCCACTGCCAGGGGCTGGTGG - Intergenic
1013908436 6:115245879-115245901 TAGCCACTGCCAGGGGATGGGGG - Intergenic
1013964754 6:115941331-115941353 TGGGGCCTGTCAGGGGATGGAGG + Exonic
1014150024 6:118044080-118044102 AGGCCAGTGCCTTGGGATGGAGG + Intronic
1014234502 6:118939535-118939557 TGGACACTGCCCAGGTATGGGGG - Intergenic
1014378638 6:120711062-120711084 GTGCCACTGCCAGGGCATGAGGG - Intergenic
1014466567 6:121762813-121762835 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1014840916 6:126219060-126219082 TGGCCGCTGCCAGGGGATGGAGG + Intergenic
1015309508 6:131750973-131750995 TGGCCACAGCCAGGAGAGAGGGG + Intergenic
1015720741 6:136238503-136238525 TGGCAGTTGCCAGGGGATGAGGG + Intronic
1015887656 6:137935169-137935191 TGGTGGTTGCCAGGGGATGGTGG - Intergenic
1015899849 6:138053239-138053261 TGGCCACTGTCAGGTGATGGGGG - Intergenic
1015991231 6:138945562-138945584 TGCCCCCTGCCAGGTGGTGGGGG + Exonic
1016054854 6:139567577-139567599 CAGCCACTGCCAGGGGATGGAGG + Intergenic
1016492963 6:144627624-144627646 TGGCCATTACCAGGGATTGGAGG - Intronic
1016680647 6:146825230-146825252 GGGCCCAAGCCAGGGGATGGAGG - Intergenic
1017048612 6:150370125-150370147 TGGCCTCTGTTTGGGGATGGGGG - Intronic
1017493312 6:154962860-154962882 TGGCCATTGGCAGGGGCTGTTGG + Intronic
1018696299 6:166394155-166394177 GGGCAGCTGCCAGGGGATAGGGG - Intergenic
1019309282 7:352413-352435 TGGACACTGCCAGGCCATGGTGG - Intergenic
1019779490 7:2931013-2931035 TGCCCAGTGCCAGGTGCTGGGGG - Intronic
1019922439 7:4171640-4171662 TGGCCACCACCAGTGGATGAGGG - Intronic
1019948442 7:4349445-4349467 TGGTCACTGCCAGAGGCTGTGGG - Intergenic
1020142235 7:5618799-5618821 TGGCCAGCGCCTGGGGAAGGTGG + Intergenic
1020575549 7:9922765-9922787 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
1020607492 7:10357072-10357094 TGGCCACTGCCAGGAGATGAGGG + Intergenic
1021531740 7:21654246-21654268 TGGCGGCTGCTAGGGGCTGGAGG - Intronic
1021585867 7:22207452-22207474 TGGGGACAGCCAGGGGGTGGGGG + Intronic
1021988491 7:26119966-26119988 TGGGCTCTGGCAGGGTATGGTGG - Intergenic
1022472616 7:30691069-30691091 GAGCCACTGCCAGGGGTTGGGGG + Intronic
1022533270 7:31080150-31080172 GTGCCACTGCCAGAGGAAGGAGG - Intronic
1023224483 7:37954580-37954602 TGGGGCCTGCCAGGGGGTGGGGG + Intronic
1023963823 7:44950557-44950579 TGGTGGCTGCCAGGGGCTGGGGG - Intergenic
1024774693 7:52770026-52770048 TGGTAATTGCCTGGGGATGGTGG + Intergenic
1027685465 7:81274524-81274546 AGGCCACTGCTGGGGGATGGGGG + Intergenic
1027746038 7:82075015-82075037 TGGGGTCTGTCAGGGGATGGAGG - Intronic
1027832701 7:83200309-83200331 TGGCCTCTGCCATGAAATGGTGG - Intergenic
1028078769 7:86548210-86548232 TGGGAATTGCCAGGGGTTGGGGG - Intergenic
1028911952 7:96217704-96217726 TAACAACTGCCAGGGGATGGAGG + Intronic
1029211878 7:98916034-98916056 TGACCAGGGCCAGGGGAGGGGGG - Intronic
1029292438 7:99512521-99512543 TGTCCACGGTCAGGGGATGGGGG - Exonic
1029550325 7:101234038-101234060 TGGCCACGGCCAGGTGTGGGAGG - Intronic
1029655011 7:101918518-101918540 CCGCCACTGCCAGTGGGTGGAGG + Intronic
1029709379 7:102291273-102291295 TTGCCACCGCCACGGGAGGGTGG - Intronic
1030222325 7:107110050-107110072 CGGCCACTGCTGGAGGATGGTGG - Intronic
1030629320 7:111878606-111878628 TAGCTACTGCCGGGGGATGGGGG - Intronic
1030665516 7:112273413-112273435 TGGCCACTGCTGGGGGATGGGGG + Intronic
1031553513 7:123143583-123143605 CTGCCACTGCCAGGGAATGAGGG + Intronic
1031565826 7:123296117-123296139 ACAGCACTGCCAGGGGATGGAGG - Intergenic
1031721797 7:125186588-125186610 TGGCCTCTGCCGGTAGATGGGGG - Intergenic
1031775586 7:125905105-125905127 TGGCCACTGCTGTGGGATAGGGG + Intergenic
1032169972 7:129576582-129576604 TGGTGACTGCCAGGGGCTTGAGG + Intergenic
1032423996 7:131805950-131805972 TGGTGGTTGCCAGGGGATGGGGG - Intergenic
1032537443 7:132676806-132676828 TGGGGGCTGCCAGGGGCTGGGGG - Intronic
1033410899 7:141116669-141116691 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG + Intergenic
1033644245 7:143288508-143288530 TGGCCGCTGACAGGGGACGCAGG + Exonic
1034126266 7:148674768-148674790 TGGCCACTGCCAGGGGGTGGGGG - Intergenic
1034160712 7:148992535-148992557 TGGTGACTGCCAGGCGCTGGAGG + Intergenic
1034272133 7:149808467-149808489 AGGCCACTGCCAGGGCGTGTTGG - Intergenic
1034398001 7:150842032-150842054 TAGCCACTGCCAGGGGATGGGGG - Intronic
1034854938 7:154535541-154535563 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1035564422 8:631582-631604 TAGACACTGCCAGGGAGTGGGGG + Intronic
1036137702 8:6176812-6176834 TGGGGGCTGCCAGGGGCTGGGGG + Intergenic
1036710321 8:11074328-11074350 TGGCCACTGCCAGGTCACTGTGG + Intronic
1036781723 8:11652355-11652377 TGGGGACTGCCAGGGGCTGGGGG - Intergenic
1036910911 8:12755835-12755857 TCGCCCCTGCCGGGGGTTGGGGG + Intronic
1036995944 8:13656843-13656865 TGGCAACTTGCAGAGGATGGTGG - Intergenic
1037295507 8:17396365-17396387 TAGTCACTACCAGGGGATGGGGG - Intronic
1037321313 8:17645971-17645993 TGGTGACTGCAAAGGGATGGCGG + Exonic
1037329299 8:17728123-17728145 TGGCGCTTGCCAGGGGCTGGTGG + Intronic
1037936261 8:22917028-22917050 TGGCCAATGCCAGAATATGGAGG + Intronic
1037981137 8:23255192-23255214 TGGCCACTGCCATGGGATGCAGG - Intronic
1038008705 8:23457300-23457322 TGTCCCCTGCCAGGGGCTGGGGG + Intronic
1038360582 8:26871826-26871848 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
1039099698 8:33928118-33928140 TGGGCCCTGCTAGGGGGTGGGGG + Intergenic
1039958243 8:42223560-42223582 TGGCCACTGCCTGGGGTGGAAGG + Intergenic
1040576689 8:48658682-48658704 TGGCCAATGCTGGGGGATTGTGG - Intergenic
1040743249 8:50605600-50605622 AAGCCACTGCTAGAGGATGGGGG + Intronic
1040856182 8:51950402-51950424 TGGCGGTTGCCAGGGGATGGGGG + Intergenic
1041820578 8:62028083-62028105 TGCCCACTGCCAGGGGAACATGG + Intergenic
1041955775 8:63556812-63556834 TGGCCTCTGGGAGGGGAAGGAGG - Intergenic
1042217349 8:66439436-66439458 GGACCACAGCCAGGGGAGGGAGG + Intronic
1042323509 8:67503906-67503928 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1042782820 8:72510546-72510568 TGGCCAAGCCCAGGTGATGGGGG - Intergenic
1043183017 8:77108689-77108711 GGGGGCCTGCCAGGGGATGGGGG + Intergenic
1043214872 8:77573599-77573621 TGGCTGCTGCCAGGGGATGGAGG - Intergenic
1043552629 8:81392075-81392097 TGGGCCCTGTCAGGTGATGGGGG + Intergenic
1044698388 8:94945569-94945591 TGGCTCCTGCCCAGGGATGGAGG + Intronic
1044863016 8:96541671-96541693 TGGCGGCTGCCAGGGGCTGAGGG + Intronic
1045015601 8:97999010-97999032 TGGTGGCTGCCAGGAGATGGAGG - Intronic
1045041439 8:98228087-98228109 TGGCCACTGCTGGAGGATGTGGG + Intronic
1045062343 8:98421167-98421189 GGGCCAGTGAGAGGGGATGGGGG + Intronic
1045715335 8:105037020-105037042 TGGGGCCTGCCAGGTGATGGGGG - Intronic
1046628972 8:116604613-116604635 TGATCTCTGCCTGGGGATGGGGG + Intergenic
1046910462 8:119620840-119620862 TGGCAACTGCCCAGGGATGGGGG - Intronic
1047032306 8:120896071-120896093 TGGCCAGAACCAGGGGAAGGGGG + Intergenic
1047352554 8:124089368-124089390 GGGCCACTGCCAGGGAATGGGGG + Intronic
1047900974 8:129422348-129422370 TGGCCACTGCCTGGGGATGAGGG - Intergenic
1048646552 8:136427586-136427608 CGGTCACTGCCAGTGGATTGGGG - Intergenic
1048966635 8:139619405-139619427 ATGCCACTGAGAGGGGATGGAGG + Intronic
1048997232 8:139801511-139801533 TGGACACAGCCAAGGGAAGGGGG - Intronic
1049370422 8:142261652-142261674 TGGCCACGGCCCCGGGGTGGGGG + Intronic
1049377448 8:142295981-142296003 CGGCCACTGTCATGGGAGGGGGG + Intronic
1049657988 8:143807238-143807260 TGCCCACCTCCAGGTGATGGTGG + Intronic
1049671061 8:143870064-143870086 TGGCCACTGGCATGGGGAGGTGG + Exonic
1049797537 8:144503543-144503565 TGAGCACTGCGAGGGGCTGGGGG - Intronic
1050411022 9:5365026-5365048 TGTCCACTGACAGGGCATAGAGG + Intronic
1050604188 9:7283639-7283661 TGGGCAGTGCAAGGGGTTGGGGG - Intergenic
1050721831 9:8600046-8600068 AGGCTGCAGCCAGGGGATGGGGG - Intronic
1051464930 9:17367134-17367156 TGGCCACTGCCAGGAGATAGGGG - Intronic
1051497255 9:17737190-17737212 TGGCGCCTGTCAGGGGGTGGGGG + Intronic
1051599578 9:18859277-18859299 GGGCCACAGCCAAGGGATGCAGG - Intronic
1051916625 9:22216732-22216754 TTGCCACTGCCAAGGAAGGGGGG - Intergenic
1052093870 9:24361676-24361698 TGGCCACTGCTGGAGAATGGGGG - Intergenic
1052381889 9:27780660-27780682 TGGGGACTGTCAGGGGGTGGGGG - Intergenic
1052450615 9:28625341-28625363 TGGCCACTGCCAGGAGATGGGGG + Intronic
1052546072 9:29881248-29881270 TGGCGAGTTCCAGGGGCTGGTGG - Intergenic
1052589510 9:30473156-30473178 TGGCCTGTCCCAGGGGAAGGAGG + Intergenic
1053014549 9:34654492-34654514 TGGCTGCTGCCAGAGGCTGGGGG - Intronic
1053548163 9:39045596-39045618 TGGTCATTGCCTGGGGCTGGGGG - Intergenic
1053812285 9:41865634-41865656 TGGTCATTGCCTGGGGCTGGGGG - Intergenic
1054618310 9:67321805-67321827 TGGTCATTGCCTGGGGCTGGGGG + Intergenic
1054803130 9:69372351-69372373 TGGTGATTGCCAGGGGCTGGAGG - Intronic
1054804303 9:69383329-69383351 TAGTGGCTGCCAGGGGATGGGGG - Intronic
1054831870 9:69634175-69634197 TGGTCGTTGCCAGGGGATGGAGG - Intronic
1054982446 9:71222700-71222722 TGGCTGCTGCTGGGGGATGGGGG - Intronic
1055227250 9:74014508-74014530 CGGCCACTGCCATGGGATGGGGG - Intergenic
1055349758 9:75374223-75374245 TTGCCACTGGCAGGAGAAGGGGG - Intergenic
1055910949 9:81350592-81350614 TAGTCACTGCCAGGGGATGGGGG - Intergenic
1056020652 9:82434791-82434813 TGGGCACTGACAAGGGATGTGGG - Intergenic
1056394392 9:86168361-86168383 TGGTCCCAGCCAGGGTATGGGGG - Intergenic
1056679254 9:88702817-88702839 TGACCACTGCTAGAGCATGGAGG + Intergenic
1057258817 9:93572731-93572753 TGGTGGCTGCCAGGGGCTGGAGG + Intergenic
1058227132 9:102379234-102379256 TGGGGCCTGTCAGGGGATGGGGG - Intergenic
1058726640 9:107810849-107810871 TGCCCACTACTAGGGCATGGAGG + Intergenic
1058820762 9:108727622-108727644 TGGCCCCTGATGGGGGATGGAGG - Intergenic
1059327186 9:113511196-113511218 TCGCCACTGCCAGGGCAGGGTGG + Intronic
1060834649 9:126745959-126745981 TGGTTGATGCCAGGGGATGGGGG + Intergenic
1060895158 9:127212482-127212504 TTGGCATTGCCAGGGGGTGGTGG + Intronic
1061004692 9:127921861-127921883 TCGCCTCTGCCAGTGGGTGGAGG - Exonic
1061409990 9:130415158-130415180 GGAACACTGCCAGGGGAAGGAGG - Intronic
1061560759 9:131401341-131401363 TGGCCGCCGCCACTGGATGGGGG - Intronic
1061596251 9:131631341-131631363 TGGCAGCTGCCAGGGGCTGGGGG - Intronic
1061641055 9:131956244-131956266 TGGTGGCTGCCAGGAGATGGTGG + Intronic
1061674021 9:132205434-132205456 TGGTGGCTGCCAGGGGCTGGGGG + Intronic
1061729717 9:132604386-132604408 TGGCCTCTGTCAGGGGAGGCAGG - Intronic
1061820923 9:133226815-133226837 TGGCCAGTGCCAGGAGGTGAAGG - Intergenic
1061874160 9:133535601-133535623 TGGCCAATTCCAGGGGAAGAAGG - Intronic
1062350846 9:136137956-136137978 TGGCCGCTGGCAGGGGATGGGGG - Intergenic
1062408501 9:136409741-136409763 TGGCCACTGCCCGGCTGTGGAGG + Intronic
1203451146 Un_GL000219v1:118192-118214 TGGGAATTGTCAGGGGATGGGGG - Intergenic
1185493456 X:536829-536851 TGGACATAGCCAGGGGCTGGAGG + Intergenic
1185523601 X:760343-760365 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1185772496 X:2775452-2775474 TCGTGACTGCCAGGGGCTGGAGG + Intronic
1186261493 X:7784752-7784774 TGGCCATTGCCAGGGACTTGGGG + Intergenic
1186267834 X:7850936-7850958 TGGTCATTGCTAGGGGCTGGGGG - Intergenic
1186301392 X:8203509-8203531 TGGCCAATGCCAAGAGATTGTGG + Intergenic
1186440973 X:9586468-9586490 TGGCAGTTGCCAGGGGCTGGGGG + Intronic
1186583135 X:10842421-10842443 TGGCCACTGCAGGGAGATGAGGG - Intergenic
1186859435 X:13656925-13656947 TGGTGATTGCCAGGGGCTGGAGG + Intronic
1187579434 X:20592563-20592585 AGGCCACTGCCAGGGAATGGGGG + Intergenic
1187612748 X:20960575-20960597 CAGCTACTGCCAGGGGATGGGGG - Intergenic
1187814310 X:23214564-23214586 TGGGGACTGTCAGGGGATGGGGG + Intergenic
1187836107 X:23434182-23434204 ATGCCACTGCTAGGGGATGGGGG - Intergenic
1187880793 X:23845513-23845535 TGGCGATTGCCAGGGATTGGGGG - Intronic
1188668254 X:32851693-32851715 TGGCCTCTGCCAGGGGATGGGGG - Intronic
1188716561 X:33465522-33465544 TGGCCAGTGTCAGGGGCTGGGGG + Intergenic
1189059050 X:37733008-37733030 TGGCAATTGCCAGGGCCTGGGGG - Intronic
1189114926 X:38332386-38332408 TTTCCACTGACAGGGGATGGGGG - Intronic
1189290822 X:39884743-39884765 TGGCAGTTGCCAGGGAATGGGGG + Intergenic
1189426367 X:40905083-40905105 TGGTAGCTGCCAGGGGCTGGGGG + Intergenic
1189599659 X:42609559-42609581 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1189628036 X:42920680-42920702 CAGCTACTGCCAGGGTATGGGGG - Intergenic
1189869902 X:45370852-45370874 CGGCTACTGCCAGGGGATGGAGG - Intergenic
1189935981 X:46068179-46068201 CCTCCACTGCCAGGGGATGGGGG + Intergenic
1190122606 X:47674606-47674628 TGGCCACTGCCAGATGGTGAGGG + Intergenic
1190216300 X:48481615-48481637 AGGCCTCTGCCAGGGGAAGGTGG - Exonic
1190445617 X:50520923-50520945 TGGTGACTGCCTGGGGTTGGTGG - Intergenic
1190537118 X:51440531-51440553 TGGCTCCTGCTGGGGGATGGGGG - Intergenic
1191760093 X:64637093-64637115 TGGCCACTGTCAAGGGATGAGGG + Intergenic
1191812507 X:65204092-65204114 TGGCTGCTGCCAGGATATGGAGG + Intergenic
1191986470 X:66986286-66986308 TGGCCACTGTCAGAGGATAGAGG + Intergenic
1192134936 X:68588473-68588495 TCTCTACTGCCAGGGGATGAGGG - Intergenic
1192150171 X:68707152-68707174 TGGCCCTCGCCAGAGGATGGGGG - Intronic
1192260122 X:69501149-69501171 AGGCTAAAGCCAGGGGATGGAGG - Intergenic
1192875360 X:75223702-75223724 TGGTCACTGCTGGGGGATGGAGG + Intergenic
1193004931 X:76605956-76605978 TGGCCGCTGCTGAGGGATGGAGG - Intergenic
1193204977 X:78737214-78737236 CCACCACTGCCAGGGGTTGGGGG + Intergenic
1193219778 X:78910512-78910534 CAACCACTGCCAGGGGATGGGGG + Intergenic
1193293514 X:79806210-79806232 TTGCCACTGCTGTGGGATGGAGG + Intergenic
1193396498 X:80990177-80990199 TGGCCACTGCAAGGGGATGGAGG - Intergenic
1193596539 X:83452305-83452327 CAGCCACTGCCAGGGGATGGGGG + Intergenic
1193802337 X:85951854-85951876 TGGCCACTGCCGTGGAATTGGGG - Intronic
1194112554 X:89853519-89853541 TGGACACTGCCAGGGGATGAAGG - Intergenic
1194220035 X:91178291-91178313 CAGCTACTGCCAGTGGATGGAGG + Intergenic
1194291179 X:92073156-92073178 TGGCCACAACCTGGGGCTGGGGG + Intronic
1194390511 X:93312154-93312176 TTGCCAGTGCCTGGGGATAGAGG + Intergenic
1194554768 X:95342529-95342551 TGGGTACTGTCAGGGGAGGGCGG + Intergenic
1194623476 X:96201452-96201474 TTGCTGCTGCCAGGGGTTGGGGG - Intergenic
1195090245 X:101451427-101451449 TGGCTGCTGCCAGGAGATGGGGG + Intronic
1195477451 X:105303097-105303119 TGGTTGCTGCCAGGGCATGGAGG + Intronic
1195501961 X:105612649-105612671 TGACTGCTGTCAGGGGATGGGGG - Intronic
1195662758 X:107397091-107397113 TGGTTACTGTCAGGGGGTGGGGG + Intergenic
1196161742 X:112492390-112492412 TGGTGATTGCCAGGGGCTGGGGG + Intergenic
1196201898 X:112896017-112896039 TGGTCACAGGCAGAGGATGGAGG - Intergenic
1196490476 X:116259761-116259783 TGGTGATTGCCAGGGGATGTGGG + Intergenic
1196512199 X:116524647-116524669 CAGCCACTGCCAGAGGATGTAGG + Intergenic
1196639121 X:118038441-118038463 TGGCCACTGCCAGGGGATGGAGG - Intronic
1197382873 X:125766504-125766526 TGGCCACTGCTAGGGGATGTTGG + Intergenic
1197468475 X:126837134-126837156 TGCCTGCTGCCAGGGGAGGGAGG - Intergenic
1197587369 X:128364663-128364685 TGGCCACTATCTGGGGGTGGGGG + Intergenic
1198190354 X:134298799-134298821 TTGGCACTGCCAGGGGTGGGGGG - Intergenic
1198412515 X:136385944-136385966 TAGCCACTGGGAGGTGATGGGGG - Intronic
1198611865 X:138410913-138410935 TGGCCACTGCCAGAGGGGTGGGG - Intergenic
1198652615 X:138879661-138879683 TGGGGACTGTCAGGGGGTGGGGG - Intronic
1198663294 X:138995112-138995134 TGACCATTGCTAGGGGATGGGGG - Intronic
1198680208 X:139173555-139173577 TGGGGCCTGTCAGGGGATGGGGG - Intronic
1199000542 X:142631380-142631402 TGGGGCCTGTCAGGGGATGGGGG + Intergenic
1199223033 X:145339656-145339678 TGGCCACTGCCATGGGATGGGGG - Intergenic
1199314824 X:146364167-146364189 TGGTCACTGTGAGGGGATGGGGG + Intergenic
1199568918 X:149247311-149247333 TGGACCCTGCCAGGGGATGCGGG + Intergenic
1200139107 X:153889090-153889112 TGGCCAAGGGCAGGGGGTGGTGG - Intronic
1200315772 X:155132068-155132090 TGGTCGCTACCAGGAGATGGAGG - Intronic
1200364376 X:155645680-155645702 TGGCCACTGCCAGAGGGTTGGGG + Intronic
1200370103 X:155715924-155715946 TGGCCACTGCCAGGGGATGGAGG + Intergenic
1200465206 Y:3508331-3508353 TGGACACTGCCAGGGGATGAAGG - Intergenic
1200556546 Y:4642052-4642074 CAGCTACTGCCAGTGGATGGAGG + Intergenic
1200608687 Y:5297731-5297753 TGGCCACAACCAGGGGCTGGGGG + Intronic
1201298246 Y:12484000-12484022 TCGTGACTGCCAGGGGCTGGAGG - Intergenic
1201437846 Y:13978766-13978788 TGGTCATTGCTAGGGGCTGGGGG + Intergenic
1201727394 Y:17168933-17168955 TGGGGACTGTCAGGGGGTGGAGG - Intergenic
1202274929 Y:23107470-23107492 TGGCAGTTGCCAGGGAATGGCGG + Intergenic
1202291099 Y:23313219-23313241 TGGCAGTTGCCAGGGAATGGCGG - Intergenic
1202427920 Y:24741192-24741214 TGGCAGTTGCCAGGGAATGGCGG + Intergenic
1202442871 Y:24928899-24928921 TGGCAGTTGCCAGGGAATGGCGG - Intergenic
1202589316 Y:26465830-26465852 TGTCCATGGGCAGGGGATGGTGG - Intergenic