ID: 1033542491

View in Genome Browser
Species Human (GRCh38)
Location 7:142369665-142369687
Sequence CCACTGCCAGGGGATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542476_1033542491 18 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542481_1033542491 -10 Left 1033542481 7:142369652-142369674 CCAAGCCATATGGCCACTGCCAG No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542478_1033542491 12 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542479_1033542491 11 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542477_1033542491 17 Left 1033542477 7:142369625-142369647 CCTAACCCAAATGCACAGACTGT No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542491 Original CRISPR CCACTGCCAGGGGATGGGGG AGG Intergenic
No off target data available for this crispr