ID: 1033544331

View in Genome Browser
Species Human (GRCh38)
Location 7:142386204-142386226
Sequence CTGTGTGACCCTTTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033544324_1033544331 12 Left 1033544324 7:142386169-142386191 CCTCACTCTGACCCTACCATGAA No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544325_1033544331 1 Left 1033544325 7:142386180-142386202 CCCTACCATGAACCCCAAACTCT No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544323_1033544331 15 Left 1033544323 7:142386166-142386188 CCTCCTCACTCTGACCCTACCAT No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544327_1033544331 -4 Left 1033544327 7:142386185-142386207 CCATGAACCCCAAACTCTTCTGT No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544322_1033544331 16 Left 1033544322 7:142386165-142386187 CCCTCCTCACTCTGACCCTACCA No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544326_1033544331 0 Left 1033544326 7:142386181-142386203 CCTACCATGAACCCCAAACTCTT No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544320_1033544331 21 Left 1033544320 7:142386160-142386182 CCAGCCCCTCCTCACTCTGACCC No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data
1033544321_1033544331 17 Left 1033544321 7:142386164-142386186 CCCCTCCTCACTCTGACCCTACC No data
Right 1033544331 7:142386204-142386226 CTGTGTGACCCTTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033544331 Original CRISPR CTGTGTGACCCTTTGTCTCC TGG Intergenic
No off target data available for this crispr