ID: 1033544390

View in Genome Browser
Species Human (GRCh38)
Location 7:142386663-142386685
Sequence CTTTTTGTGCAGAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033544390_1033544398 -1 Left 1033544390 7:142386663-142386685 CCAGCTGCCCTCTGCACAAAAAG No data
Right 1033544398 7:142386685-142386707 GGGCAGTCACAGGCTGGAGGTGG No data
1033544390_1033544397 -4 Left 1033544390 7:142386663-142386685 CCAGCTGCCCTCTGCACAAAAAG No data
Right 1033544397 7:142386682-142386704 AAAGGGCAGTCACAGGCTGGAGG No data
1033544390_1033544399 0 Left 1033544390 7:142386663-142386685 CCAGCTGCCCTCTGCACAAAAAG No data
Right 1033544399 7:142386686-142386708 GGCAGTCACAGGCTGGAGGTGGG No data
1033544390_1033544400 12 Left 1033544390 7:142386663-142386685 CCAGCTGCCCTCTGCACAAAAAG No data
Right 1033544400 7:142386698-142386720 CTGGAGGTGGGCACTCCTTATGG No data
1033544390_1033544396 -7 Left 1033544390 7:142386663-142386685 CCAGCTGCCCTCTGCACAAAAAG No data
Right 1033544396 7:142386679-142386701 CAAAAAGGGCAGTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033544390 Original CRISPR CTTTTTGTGCAGAGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr