ID: 1033544524

View in Genome Browser
Species Human (GRCh38)
Location 7:142388251-142388273
Sequence CATCAGGTACTGTAGCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033544519_1033544524 12 Left 1033544519 7:142388216-142388238 CCTGAAATAAGTAGGAGAGGATG No data
Right 1033544524 7:142388251-142388273 CATCAGGTACTGTAGCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033544524 Original CRISPR CATCAGGTACTGTAGCTCTA AGG Intergenic
No off target data available for this crispr