ID: 1033546387

View in Genome Browser
Species Human (GRCh38)
Location 7:142405200-142405222
Sequence CAGTAGGAATAGATGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033546383_1033546387 0 Left 1033546383 7:142405177-142405199 CCGCAGGCGGGGCTCTGGCAAGA No data
Right 1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG No data
1033546381_1033546387 5 Left 1033546381 7:142405172-142405194 CCAAACCGCAGGCGGGGCTCTGG No data
Right 1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG No data
1033546379_1033546387 11 Left 1033546379 7:142405166-142405188 CCACGGCCAAACCGCAGGCGGGG No data
Right 1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033546387 Original CRISPR CAGTAGGAATAGATGGAGTT GGG Intergenic
No off target data available for this crispr