ID: 1033547314

View in Genome Browser
Species Human (GRCh38)
Location 7:142413208-142413230
Sequence CAGGGTCCCTCCGATGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033547314_1033547318 -10 Left 1033547314 7:142413208-142413230 CCTGGACCATCGGAGGGACCCTG No data
Right 1033547318 7:142413221-142413243 AGGGACCCTGTTCCCCAGGGAGG No data
1033547314_1033547320 -8 Left 1033547314 7:142413208-142413230 CCTGGACCATCGGAGGGACCCTG No data
Right 1033547320 7:142413223-142413245 GGACCCTGTTCCCCAGGGAGGGG No data
1033547314_1033547321 -7 Left 1033547314 7:142413208-142413230 CCTGGACCATCGGAGGGACCCTG No data
Right 1033547321 7:142413224-142413246 GACCCTGTTCCCCAGGGAGGGGG No data
1033547314_1033547319 -9 Left 1033547314 7:142413208-142413230 CCTGGACCATCGGAGGGACCCTG No data
Right 1033547319 7:142413222-142413244 GGGACCCTGTTCCCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033547314 Original CRISPR CAGGGTCCCTCCGATGGTCC AGG (reversed) Intergenic
No off target data available for this crispr