ID: 1033549274

View in Genome Browser
Species Human (GRCh38)
Location 7:142431814-142431836
Sequence CAGTAAGAACAGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033549270_1033549274 11 Left 1033549270 7:142431780-142431802 CCATAACTAAACTATAGGACAGG No data
Right 1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033549274 Original CRISPR CAGTAAGAACAGATGGAACT GGG Intergenic
No off target data available for this crispr