ID: 1033551668

View in Genome Browser
Species Human (GRCh38)
Location 7:142452989-142453011
Sequence GAAGCTGTTCCCACTCTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033551659_1033551668 17 Left 1033551659 7:142452949-142452971 CCGGGGGCACAGGAAAAGGCCAA No data
Right 1033551668 7:142452989-142453011 GAAGCTGTTCCCACTCTACGGGG No data
1033551664_1033551668 -2 Left 1033551664 7:142452968-142452990 CCAAGGAAACCTGCTTCTGGGGA No data
Right 1033551668 7:142452989-142453011 GAAGCTGTTCCCACTCTACGGGG No data
1033551657_1033551668 24 Left 1033551657 7:142452942-142452964 CCTTGAACCGGGGGCACAGGAAA No data
Right 1033551668 7:142452989-142453011 GAAGCTGTTCCCACTCTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033551668 Original CRISPR GAAGCTGTTCCCACTCTACG GGG Intergenic
No off target data available for this crispr