ID: 1033555897

View in Genome Browser
Species Human (GRCh38)
Location 7:142488418-142488440
Sequence CAGAGTGGCCCCAAGTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033555888_1033555897 14 Left 1033555888 7:142488381-142488403 CCTGTGCAGAGATCTCTGCACCA No data
Right 1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG No data
1033555891_1033555897 -6 Left 1033555891 7:142488401-142488423 CCAGGAACCTTGGAACCCAGAGT No data
Right 1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG No data
1033555887_1033555897 15 Left 1033555887 7:142488380-142488402 CCCTGTGCAGAGATCTCTGCACC No data
Right 1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033555897 Original CRISPR CAGAGTGGCCCCAAGTGGCC CGG Intergenic
No off target data available for this crispr