ID: 1033556692

View in Genome Browser
Species Human (GRCh38)
Location 7:142494370-142494392
Sequence TGTGATCCTGAATCTTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033556692_1033556696 24 Left 1033556692 7:142494370-142494392 CCATTCCAAGATTCAGGATCACA No data
Right 1033556696 7:142494417-142494439 GAGGTGTGCTATAGTTGCTGTGG No data
1033556692_1033556694 5 Left 1033556692 7:142494370-142494392 CCATTCCAAGATTCAGGATCACA No data
Right 1033556694 7:142494398-142494420 ATCCTATCATGAAAACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033556692 Original CRISPR TGTGATCCTGAATCTTGGAA TGG (reversed) Intergenic
No off target data available for this crispr