ID: 1033556716

View in Genome Browser
Species Human (GRCh38)
Location 7:142494617-142494639
Sequence TATGCTGGTACACCACAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033556707_1033556716 25 Left 1033556707 7:142494569-142494591 CCCCTTTCAGTGAAGCCATGTTG No data
Right 1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG No data
1033556711_1033556716 10 Left 1033556711 7:142494584-142494606 CCATGTTGGCTGCTTGAAGTCTG No data
Right 1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG No data
1033556708_1033556716 24 Left 1033556708 7:142494570-142494592 CCCTTTCAGTGAAGCCATGTTGG No data
Right 1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG No data
1033556710_1033556716 23 Left 1033556710 7:142494571-142494593 CCTTTCAGTGAAGCCATGTTGGC No data
Right 1033556716 7:142494617-142494639 TATGCTGGTACACCACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033556716 Original CRISPR TATGCTGGTACACCACAAAT TGG Intergenic
No off target data available for this crispr