ID: 1033557719

View in Genome Browser
Species Human (GRCh38)
Location 7:142503272-142503294
Sequence AAGGAGGAGATTAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033557719_1033557725 5 Left 1033557719 7:142503272-142503294 CCTTCCTGCCTAATCTCCTCCTT No data
Right 1033557725 7:142503300-142503322 TCCTTCCCTCACAGGTGTCCTGG No data
1033557719_1033557724 -3 Left 1033557719 7:142503272-142503294 CCTTCCTGCCTAATCTCCTCCTT No data
Right 1033557724 7:142503292-142503314 CTTCAATCTCCTTCCCTCACAGG No data
1033557719_1033557729 11 Left 1033557719 7:142503272-142503294 CCTTCCTGCCTAATCTCCTCCTT No data
Right 1033557729 7:142503306-142503328 CCTCACAGGTGTCCTGGATTTGG No data
1033557719_1033557730 12 Left 1033557719 7:142503272-142503294 CCTTCCTGCCTAATCTCCTCCTT No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033557719 Original CRISPR AAGGAGGAGATTAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr