ID: 1033557730

View in Genome Browser
Species Human (GRCh38)
Location 7:142503307-142503329
Sequence CTCACAGGTGTCCTGGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033557720_1033557730 8 Left 1033557720 7:142503276-142503298 CCTGCCTAATCTCCTCCTTCAAT No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557717_1033557730 20 Left 1033557717 7:142503264-142503286 CCCTATCGCCTTCCTGCCTAATC No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557718_1033557730 19 Left 1033557718 7:142503265-142503287 CCTATCGCCTTCCTGCCTAATCT No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557719_1033557730 12 Left 1033557719 7:142503272-142503294 CCTTCCTGCCTAATCTCCTCCTT No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557721_1033557730 4 Left 1033557721 7:142503280-142503302 CCTAATCTCCTCCTTCAATCTCC No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557723_1033557730 -7 Left 1033557723 7:142503291-142503313 CCTTCAATCTCCTTCCCTCACAG No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557722_1033557730 -4 Left 1033557722 7:142503288-142503310 CCTCCTTCAATCTCCTTCCCTCA No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data
1033557716_1033557730 28 Left 1033557716 7:142503256-142503278 CCTATCTGCCCTATCGCCTTCCT No data
Right 1033557730 7:142503307-142503329 CTCACAGGTGTCCTGGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033557730 Original CRISPR CTCACAGGTGTCCTGGATTT GGG Intergenic
No off target data available for this crispr