ID: 1033562429

View in Genome Browser
Species Human (GRCh38)
Location 7:142545177-142545199
Sequence CAAAATGATGATGGAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033562429_1033562431 -7 Left 1033562429 7:142545177-142545199 CCTACATCTCCATCATCATTTTG No data
Right 1033562431 7:142545193-142545215 CATTTTGCACAAGTCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033562429 Original CRISPR CAAAATGATGATGGAGATGT AGG (reversed) Intergenic
No off target data available for this crispr