ID: 1033564497

View in Genome Browser
Species Human (GRCh38)
Location 7:142565437-142565459
Sequence CTGGATTAGTAGCAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033564497_1033564500 28 Left 1033564497 7:142565437-142565459 CCTTCTGCCTGCTACTAATCCAG 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1033564500 7:142565488-142565510 AGACAATTTATTCACTCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033564497 Original CRISPR CTGGATTAGTAGCAGGCAGA AGG (reversed) Intergenic
900977407 1:6026156-6026178 CTGGATGAGCAGCGGCCAGATGG - Intronic
901226614 1:7616694-7616716 ATGGAACACTAGCAGGCAGAGGG + Intronic
901486489 1:9566487-9566509 CAGGATGAGTATCTGGCAGAGGG - Intronic
903227317 1:21901325-21901347 TAGGATTAGTATCATGCAGAGGG + Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904774100 1:32896125-32896147 CTGGACTATGAGGAGGCAGATGG - Intronic
905865916 1:41376575-41376597 CAGGATGAGAAGCAGGCAGTGGG - Intronic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
912505935 1:110156126-110156148 CCAAATTACTAGCAGGCAGATGG - Intronic
915155032 1:153868376-153868398 CTGGCTTAATAGCAGACAGCTGG + Intronic
917136579 1:171793980-171794002 CTGGGGTAGTAGGGGGCAGATGG - Intronic
917203159 1:172538997-172539019 CTGGAATGGAAGCAGGCAGTAGG + Intronic
917452509 1:175158607-175158629 CTGGGTTTGGTGCAGGCAGATGG + Intronic
917657985 1:177146181-177146203 CTGGCTTAATAGAAGACAGATGG + Intronic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
920362159 1:205426557-205426579 CTGGATTGGCAGGAAGCAGAAGG + Intronic
920411812 1:205767545-205767567 CTGAATTGGTACTAGGCAGATGG + Intergenic
1063508119 10:6619998-6620020 ATCGTTTATTAGCAGGCAGATGG - Intergenic
1064527472 10:16272621-16272643 CTGGATTGGTAGGAGGTAGGAGG - Intergenic
1066593385 10:37020864-37020886 CAGGCTTAGTTACAGGCAGATGG - Intergenic
1067148150 10:43708623-43708645 TTGGGTTATCAGCAGGCAGAAGG + Intergenic
1068123130 10:52805606-52805628 GGGGATTTGTAGCACGCAGAGGG - Intergenic
1071713237 10:88070386-88070408 CTTGATTAAAAGCAGGGAGATGG - Intergenic
1073165368 10:101444065-101444087 CTGGCTTAGTAGCAGTCCTAAGG + Intronic
1074608439 10:114997506-114997528 CTGCATTTGTAGCAGGTAAAGGG + Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1077581524 11:3420418-3420440 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1078086324 11:8234813-8234835 CTGGAGTAGTAGCAGAGTGAAGG - Intronic
1081613785 11:44578796-44578818 CTGCATTAGGAGCTGGCATAGGG + Intronic
1081826497 11:46058871-46058893 CTGTACTCGTAGCAGGCAAAAGG - Intronic
1084238437 11:67803236-67803258 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1084833972 11:71789589-71789611 CTGGATGAGTCACAGGAAGAAGG - Intronic
1085511686 11:77091396-77091418 CTGGAGTGGAGGCAGGCAGAGGG + Intronic
1085706957 11:78794988-78795010 CTGGACAAGTAGCTGCCAGATGG + Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1089118598 11:116115514-116115536 CTGGCCTAGAAGCAGGGAGATGG + Intergenic
1089562070 11:119348438-119348460 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
1091702768 12:2674692-2674714 CTGGAGGAGAGGCAGGCAGAGGG - Intronic
1091899570 12:4134159-4134181 CTGGACCAGTAGCAGGCTGGTGG - Intergenic
1092291532 12:7162337-7162359 CTGGTTTGGTAACAGGAAGAAGG - Intergenic
1092409129 12:8240877-8240899 CTGGATGAGTCACAGGAAGAAGG + Intergenic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1102939525 12:116927147-116927169 GTGGATTGGGAACAGGCAGAGGG + Intronic
1104026743 12:125033004-125033026 CGGGATTGGCAGCGGGCAGAAGG - Intergenic
1104348126 12:128020989-128021011 CTGGAGTAGGAACATGCAGATGG - Intergenic
1106423446 13:29603163-29603185 CTGGAACAAAAGCAGGCAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107186987 13:37534903-37534925 ATGTATTTATAGCAGGCAGATGG + Intergenic
1107490746 13:40878147-40878169 CTGGATTGGGAACAGGCAGCAGG + Intergenic
1109137127 13:58666471-58666493 TTGGATTAGTAACTCGCAGATGG - Intergenic
1109533754 13:63688116-63688138 CCGAATTAGTAGAAGGCAGTTGG - Intergenic
1113198655 13:107839216-107839238 CTGGAATAGGAGCAGGAAGATGG - Intronic
1113548368 13:111172670-111172692 CTGGGTTAATAGCAGAGAGAGGG + Intronic
1117828642 14:59728473-59728495 CTGGATAAACATCAGGCAGAAGG - Intronic
1119918159 14:78421956-78421978 TTGGAATGGGAGCAGGCAGAGGG + Intronic
1120864179 14:89281419-89281441 TTGCATTTGTAGCAGGCAGGTGG - Intronic
1124468104 15:29958323-29958345 CTGGATAAGTAGCATGTAGCTGG + Intronic
1125599094 15:40906056-40906078 CTGGCTTAGGAGAAGACAGAAGG - Intergenic
1128657070 15:69470183-69470205 CTGGCTTAGGAGCAGCCAGTTGG + Intergenic
1130083986 15:80761965-80761987 CTGGATGGGTTCCAGGCAGAGGG + Intergenic
1130912589 15:88281303-88281325 CAGGATTGCTGGCAGGCAGAGGG + Intergenic
1131877332 15:96823886-96823908 CTGGCTTAGTAGAAGGCAACTGG + Intergenic
1133350094 16:5095686-5095708 CTGGATGAGTCACAGGAAGAAGG + Intronic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1139301070 16:65945806-65945828 CTGGCTTAGTAGAATGCTGATGG - Intergenic
1139319162 16:66099455-66099477 CTCCTTTAGTAGCAGACAGATGG - Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1143733218 17:8893153-8893175 CTGTTTTAGTAACAGACAGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1148897901 17:50850891-50850913 CTGGTATATTAGCAGGGAGAAGG - Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1151110374 17:71669148-71669170 CTTGATTGGTAGAAAGCAGATGG + Intergenic
1153258555 18:3198381-3198403 CTGGAGTAGTCACAGGCAGTGGG - Intronic
1155473148 18:26211708-26211730 CTGGCTTAGTAGAAGACAGCTGG - Intergenic
1155594108 18:27462754-27462776 CTGGAATAAAAGCAAGCAGAAGG + Intergenic
1158758060 18:60350225-60350247 ATGGATTGTTAGCAGGCAGCAGG + Intergenic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166563720 19:43750513-43750535 CTGGATTAGTGCCTGGCACATGG + Intronic
1166936959 19:46339778-46339800 CCAGATTGGGAGCAGGCAGAGGG - Exonic
1167670148 19:50847418-50847440 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
929247421 2:39718252-39718274 CTGGATACATACCAGGCAGATGG - Intergenic
930491169 2:52074503-52074525 CTGCATTAGAAACAGGAAGAAGG + Intergenic
936046849 2:109195106-109195128 CTATATTTGTAGCTGGCAGATGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938224624 2:129605165-129605187 CTGGCTTACCAGCAAGCAGATGG + Intergenic
940018720 2:149134166-149134188 CTGGAGAAGGATCAGGCAGAGGG + Intronic
943782186 2:191836953-191836975 CTGTATCAGTGACAGGCAGAGGG + Intronic
945736707 2:213609895-213609917 CTGGATTATGAATAGGCAGAGGG - Intronic
947664215 2:231893145-231893167 CTGGAGTAGTGGCTGGCACATGG + Intergenic
1169859641 20:10137809-10137831 CAGGATGTGAAGCAGGCAGAGGG - Intergenic
1172335630 20:34113091-34113113 CTGGATTAGATGCAGTCAGGAGG + Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1179148353 21:38788737-38788759 CTGGTTTAATAGAAGGCAGCTGG - Intergenic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
952759030 3:36897479-36897501 CTAGAGTAGTAGCAGGCAGTGGG - Intronic
954317204 3:49807580-49807602 CTGGCTTCATAGCAGGAAGAGGG + Intronic
954619898 3:51989540-51989562 CTAGATGAGGGGCAGGCAGAGGG + Intergenic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956192434 3:66620654-66620676 GTGGATGAGTGGCAGGCAGATGG - Intergenic
956963189 3:74427339-74427361 CAGTAGTAGTAGCAGTCAGAGGG + Intronic
958055472 3:88405305-88405327 CTGAATAAGTAGCAGGGTGAAGG - Intergenic
958513772 3:95085107-95085129 CAGAATTATTAGCAGGGAGAAGG - Intergenic
959023620 3:101215580-101215602 CTGCATTAGAAGCAGGCAATTGG - Intergenic
960409187 3:117301297-117301319 TGGGAGTAGTAGCAGGCAAAAGG - Intergenic
961300454 3:125918670-125918692 CTGGATGAGTCACAGGAAGAAGG - Intergenic
961888057 3:130109408-130109430 CTGGATGAGTCACAGGAAGAAGG + Intronic
968997200 4:3953345-3953367 CTGGATGAGTCACAGGAAGAAGG + Intergenic
969756813 4:9155329-9155351 CTGGATGAGTCACAGGAAGAAGG - Intergenic
969816781 4:9692906-9692928 CTGGATGAGTCACAGGAAGAAGG - Intergenic
972666798 4:41172542-41172564 CTAGATTAGGAGCATCCAGAGGG + Intronic
973922474 4:55702515-55702537 CTGAATTAGAATCTGGCAGAAGG - Intergenic
977651213 4:99471686-99471708 GTGGATTACTTGCAGGAAGAGGG - Intergenic
986462547 5:7987189-7987211 GTGAAGTAGCAGCAGGCAGATGG + Intergenic
986955297 5:13143218-13143240 CTGGATTAGTACTTGCCAGAAGG + Intergenic
987381251 5:17287987-17288009 CTGGAAAAGTTCCAGGCAGAGGG - Intergenic
990320173 5:54621970-54621992 CCGGATTATTACCAGGCAGTTGG - Intergenic
991274768 5:64831848-64831870 CTGGTTTAATAGAAGGCAGCTGG + Intronic
994183803 5:96796912-96796934 TAGGACTAGTAGCAGGCACAAGG + Intronic
994893683 5:105672336-105672358 CGGGACTACTAGCAGGGAGAGGG - Intergenic
999755404 5:154660562-154660584 CTGGCTGCGTAGCAGGCAGCTGG - Intergenic
999977120 5:156922792-156922814 CTGGCTTAATAGGAGACAGAGGG - Intronic
1001085025 5:168694215-168694237 CTGAATTTAGAGCAGGCAGATGG - Intronic
1002855766 6:1036944-1036966 CTGGCTTTGTACCAGGCAGGTGG + Intergenic
1007082301 6:39116424-39116446 CTGGATTGGAAGGAGGGAGAGGG + Intergenic
1007182505 6:39940019-39940041 CTGGCTTAGTAGAAGGCAACTGG - Intergenic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1009201640 6:60753224-60753246 GTGGATTTGTGGCAGGAAGAAGG + Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012814433 6:104004242-104004264 CTAGAATAGTAGCTGCCAGAAGG - Intergenic
1014334791 6:120119949-120119971 CTGGGATAAAAGCAGGCAGAGGG + Intergenic
1014443822 6:121503359-121503381 CATGATTAGAAGCAGGCAAAAGG - Intergenic
1014663284 6:124200881-124200903 CTGGTTAATTAGCACGCAGATGG - Intronic
1015297313 6:131611095-131611117 ATGACTTAGTAGCAGGCAGTTGG + Intronic
1017409042 6:154149836-154149858 CTGGAATAGTAGAGGCCAGATGG - Intronic
1018425571 6:163677391-163677413 CTAGAATATAAGCAGGCAGAAGG + Intergenic
1019860935 7:3657503-3657525 CTGGATTTAAAGCAGGAAGAGGG + Intronic
1020013883 7:4820227-4820249 CTGGATTTGCAGCCGGCAGGTGG - Intronic
1020047438 7:5052123-5052145 CTGGAATACTAGCAGGGATAAGG - Intronic
1021168668 7:17371501-17371523 CTAGATTAGTATCTGGCACATGG - Intergenic
1021853376 7:24830267-24830289 CTGGAACAGTGGCAGGCACATGG + Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1024200038 7:47097232-47097254 GAGGCTGAGTAGCAGGCAGAGGG - Intergenic
1024863958 7:53881235-53881257 CTGCATAAGAAGCAGGCAGCAGG - Intergenic
1026447622 7:70499338-70499360 CTGGAGGAGTTCCAGGCAGAGGG + Intronic
1026727956 7:72885540-72885562 CTGGAATATTAGCAGGGATAAGG - Intronic
1027115883 7:75480245-75480267 CTGGAATATTAGCAGGGATAAGG + Intronic
1027121126 7:75521611-75521633 CTGGAATATTAGCAGGGATAAGG + Intergenic
1028091167 7:86703665-86703687 CTGGTTTAGTCAAAGGCAGATGG - Intronic
1029721661 7:102370412-102370434 CTGGAATATTAGCAGGGATAAGG - Intronic
1029899843 7:104027235-104027257 CTGGCTTACTAGAAGGCAGCTGG + Intergenic
1031452652 7:121940894-121940916 CTGGTATAGCAGCAGGCAGGGGG - Intronic
1031998959 7:128252345-128252367 CTGGAATCTCAGCAGGCAGAGGG - Intronic
1032454841 7:132065494-132065516 CTGGACCAGGAGCAGGCACAGGG - Intergenic
1033550509 7:142442924-142442946 CAAGATTAGTAGCAGACAGAAGG - Intergenic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1035820221 8:2583649-2583671 CTGGATTATCAGCAGATAGATGG - Intergenic
1036380044 8:8230649-8230671 CTGGATGAGTCACAGGAAGAAGG - Intergenic
1036849515 8:12192013-12192035 CTGGATGAGTCACAGGAAGAAGG + Intronic
1036870877 8:12434286-12434308 CTGGATGAGTCACAGGAAGAAGG + Intronic
1037170634 8:15887342-15887364 CTGGACTTGCAGCAGGCTGAGGG + Intergenic
1037469065 8:19189553-19189575 TGGGATTAGTAGCTGACAGAGGG - Intergenic
1037632385 8:20670073-20670095 CTGGCTTAGAAGCAGATAGATGG + Intergenic
1037696592 8:21229056-21229078 CTGGATTAGTAGTATGGACAGGG - Intergenic
1038395991 8:27245784-27245806 ATGGAGTAGGAGCAGGCAGTTGG + Intronic
1043381459 8:79706572-79706594 CTGGATTATTGGGAGGCAGAAGG - Intergenic
1045580859 8:103478397-103478419 CTGGAGTAGTAACAGTGAGAAGG + Intergenic
1045910936 8:107409208-107409230 CTGGTTTAGTAACAGTTAGAAGG - Intronic
1046664745 8:116988366-116988388 CTGGATTGCTAGCCAGCAGACGG - Intronic
1048970948 8:139644741-139644763 CTGGGATTGTAGCAGCCAGAGGG - Intronic
1049618504 8:143587151-143587173 CTGGCTTAGTGGGAGGCAGCTGG - Intronic
1052334663 9:27307278-27307300 CTGGAAAAGTTGCAGGCAGAAGG - Intergenic
1052427964 9:28329353-28329375 GGGGTTTAGTAACAGGCAGAAGG - Intronic
1055995057 9:82148322-82148344 GTGGATTGGCAGCAGGAAGAAGG - Intergenic
1057117486 9:92539624-92539646 CTAGATTGGTAGGAGGAAGATGG + Intronic
1057797594 9:98169788-98169810 CTGGCTTAGTTCTAGGCAGAGGG - Intronic
1058644239 9:107115916-107115938 CTGGATTAGAAACTGGAAGATGG + Intergenic
1058857709 9:109080759-109080781 CTGGATTAAAAGCTAGCAGAAGG - Intronic
1060472224 9:123957532-123957554 CTGGCTTAGACGCTGGCAGAGGG - Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1193868162 X:86762582-86762604 CTGAATTAGCAACATGCAGATGG - Intronic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1196425107 X:115561727-115561749 CTGGAGGAGTAGCAGGCTGCTGG - Intronic
1200983807 Y:9285965-9285987 CTGGCTTAGGAACAGGCAGGAGG + Intergenic
1201232917 Y:11882508-11882530 CTGGAGGAATAGCAGGCAGGAGG - Intergenic
1202126564 Y:21573735-21573757 CTGGCTTAGGAACAGGCAGGAGG - Intergenic