ID: 1033564555

View in Genome Browser
Species Human (GRCh38)
Location 7:142565983-142566005
Sequence CACCTAACTGTGGGCTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 5, 3: 6, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033564549_1033564555 20 Left 1033564549 7:142565940-142565962 CCAAGGGTGGAACAGCACAAGAC 0: 1
1: 1
2: 0
3: 6
4: 99
Right 1033564555 7:142565983-142566005 CACCTAACTGTGGGCTGCTATGG 0: 1
1: 0
2: 5
3: 6
4: 100
1033564548_1033564555 26 Left 1033564548 7:142565934-142565956 CCAGAGCCAAGGGTGGAACAGCA 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1033564555 7:142565983-142566005 CACCTAACTGTGGGCTGCTATGG 0: 1
1: 0
2: 5
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033564555 Original CRISPR CACCTAACTGTGGGCTGCTA TGG Intergenic
902981787 1:20128681-20128703 CTCCTGACTGTGGGCCTCTAGGG - Intergenic
904194272 1:28773251-28773273 CCACTAACTTTGGGCAGCTATGG + Intergenic
907039813 1:51248574-51248596 CCCTTAACTGTAGGCTCCTAGGG - Intronic
911585857 1:99689654-99689676 CACCTGACTATGGGGAGCTATGG - Exonic
923128247 1:231051419-231051441 CACTTAACTATGGGATACTAGGG + Intergenic
924003468 1:239580027-239580049 CACATAAATGAGGGCAGCTAAGG - Intronic
1064863966 10:19858304-19858326 CGCTTAACTGTGGGCTCCTGAGG + Intronic
1067489104 10:46681005-46681027 CTCTTAAGTGTGGGCTGCAAAGG + Intergenic
1067605569 10:47659368-47659390 CTCTTAAGTGTGGGCTGCAAAGG - Intergenic
1067794242 10:49309176-49309198 CATTTCACTGTTGGCTGCTATGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068774397 10:60855090-60855112 TACCTAAGTGTGGGGTGCAAAGG + Intergenic
1071621126 10:87120744-87120766 CACTCAAGTGTGGGCTGCAAAGG - Intronic
1077852348 11:6085361-6085383 CACATACCTGTGAGCTGCCAGGG - Intergenic
1080638829 11:34146664-34146686 CACCTAACCGCGGGCTGCCATGG - Exonic
1084978064 11:72814195-72814217 CACCTAAGTGGGGGCTCCTGTGG - Intergenic
1089625729 11:119749462-119749484 CCTCTGACTGAGGGCTGCTAAGG + Intergenic
1090684439 11:129100161-129100183 CTCCTAAATGTGCTCTGCTATGG - Intronic
1096209101 12:49748910-49748932 CATTTAACTGTGGGCTCCTCTGG + Intronic
1106908596 13:34438057-34438079 ATCCTATCTGTGGACTGCTAAGG + Intergenic
1107322672 13:39206003-39206025 CAACTCACTTTGGGCTGGTAAGG + Intergenic
1113454621 13:110439186-110439208 CACCTAGCTGAGGGCTGGGACGG + Intronic
1114602406 14:23967322-23967344 CAGCGGGCTGTGGGCTGCTAGGG - Intronic
1114606774 14:24004448-24004470 CAGCGGGCTGTGGGCTGCTAGGG - Intronic
1114612075 14:24049396-24049418 CAGCGGGCTGTGGGCTGCTAGGG - Intergenic
1116862881 14:50008473-50008495 CACCCAACTGAGCGCTGCAAGGG - Intergenic
1120175351 14:81287951-81287973 CACCTTGCTGTGGTCTGATACGG + Intronic
1120589845 14:86362905-86362927 CTCCTAATTGTGGTCTGCTATGG - Intergenic
1121212140 14:92215205-92215227 CACCTCACTGTTGGTTGATATGG - Intergenic
1122137555 14:99643707-99643729 AACCTAGCAGAGGGCTGCTAGGG - Intergenic
1122246086 14:100404527-100404549 CCCCTACCTGTGGGCTGCGTGGG + Intronic
1122415133 14:101545826-101545848 CACGTAACTGTGGGATGCTGGGG - Intergenic
1122721630 14:103725562-103725584 CACCCCACTGTGGGCAGCCATGG - Intronic
1123150561 14:106177540-106177562 CACACAACTGTGGGATGCTGAGG + Intergenic
1123398985 15:19965284-19965306 CACACAACTGTGGGATGCTGAGG + Intergenic
1125753920 15:42049520-42049542 CAGGTAACTGAGGGCTGCTTGGG - Intronic
1127836692 15:62796278-62796300 CACGTACCTGTGGTCTGCGAAGG - Exonic
1133585037 16:7185103-7185125 CACCTAACAGTGGGGTATTATGG + Intronic
1143338533 17:6191485-6191507 CACCTAACTCTGAGCTCCTGGGG - Intergenic
1143722916 17:8826178-8826200 CACCTGCCTCTGGGCTGCTGTGG + Intronic
1144620616 17:16816201-16816223 CCCCTCACTGTGGTCTGATAGGG - Intergenic
1144885025 17:18451946-18451968 CCCCTCACTGTGGTCTGATAGGG + Intergenic
1145147194 17:20492431-20492453 CCCCTCACTGTGGTCTGATAGGG - Intergenic
1147572005 17:41577101-41577123 CCCCTCACTGTGGTCTGATAGGG - Intergenic
1147761353 17:42799347-42799369 CACCTCTCTGTGGGGTGCTGGGG + Intronic
1149481703 17:57008721-57008743 CACCTGAATGTGGACCGCTATGG + Intergenic
1149909906 17:60557652-60557674 TACCTAACTTTGGGATGCCAAGG + Intergenic
1151381682 17:73730119-73730141 CACCTAACTGGGGGAGGGTAGGG - Intergenic
1157223363 18:45842282-45842304 CACCCAGCTGGGGGCTGCCAAGG - Exonic
1163642484 19:18469531-18469553 CACGTACCAGTGGGCTGCCATGG + Intronic
1167524104 19:49972959-49972981 CACCTCCCTGTGCCCTGCTAAGG - Intergenic
1167726292 19:51215393-51215415 CACCTCCCTGTGCGCTGCAAAGG - Intergenic
925171487 2:1752563-1752585 CACCTAACTGTGAGTTTCTCAGG - Intergenic
926957779 2:18320244-18320266 CACCTGACTGTGGGTAGCTGTGG - Intronic
927827808 2:26321571-26321593 CTCCTAACTGGGGGCTGCCATGG - Intronic
933271726 2:80240022-80240044 CAGCTAACTGTGGGCAACCATGG - Intronic
936503355 2:113083991-113084013 CACCAGACTGTGAGCTCCTAAGG + Intergenic
937265544 2:120612683-120612705 CACCTGAGAGTGGGCTCCTAAGG + Intergenic
938232206 2:129670929-129670951 CACCTGACTGTGGGAAGGTAGGG - Intergenic
938450668 2:131416721-131416743 AACATAAATCTGGGCTGCTAGGG - Intergenic
942874374 2:180776239-180776261 CACCAAATTGTGGGCTGTTCAGG - Intergenic
946978783 2:225183624-225183646 CAACTAACTGTTGGAGGCTAAGG - Intergenic
1169064735 20:2688585-2688607 CACCTGACTGTGAGCTCATAAGG + Intergenic
1170683219 20:18545228-18545250 CCCCTAACTGTGGACTCCTTGGG - Intronic
1173794376 20:45848779-45848801 CTACTAACTGAGGTCTGCTAAGG + Intronic
1176745662 21:10650018-10650040 CACACAACTGTGGGATGCTGAGG + Intergenic
1180088794 21:45523541-45523563 CCCCTCACGGTGGGCTTCTAAGG - Intronic
1181945462 22:26513520-26513542 CAGTTAAATGTGGGCTGCTTAGG + Intergenic
1183856535 22:40638452-40638474 CACCAAACTGGAGGATGCTAAGG + Intergenic
1184514340 22:44952798-44952820 CACGTCACTGAGGGCTGCCAGGG - Intronic
951861146 3:27253993-27254015 CATCTGACTGAGGGCTGCTCTGG - Intronic
953585086 3:44192588-44192610 CACCTGAGTGTGGTTTGCTAAGG - Intergenic
957493677 3:80963228-80963250 CTTCTCACTGTGGGCTGCAATGG + Intergenic
960136942 3:114115102-114115124 CACCCAACTATGGGATGCCAAGG + Intergenic
968051239 3:195656426-195656448 CACCTCACTGTGGGCTGCTGCGG + Intergenic
968104584 3:195991912-195991934 CACCTCACTGTGGGCTGCTGCGG - Intergenic
968302875 3:197629495-197629517 CACCTCACTGTGGGCTGCTGCGG - Intergenic
969490658 4:7497559-7497581 GTCCTAACTGTGGGCTCCTTTGG - Intronic
973090700 4:46132739-46132761 AACTTCACTGTTGGCTGCTAGGG - Intergenic
981377278 4:144030291-144030313 CACCTAACTAGGGGCTTCTGTGG + Intergenic
984980811 4:185279220-185279242 CACCTCACCCTGGGCTGCTCCGG + Intronic
985507928 5:295066-295088 CACCTCACTGTGGGCTGCTGCGG + Intronic
985740108 5:1610605-1610627 CACCTCACTGTGGGCTGCTGCGG - Intergenic
987964592 5:24855230-24855252 CACCTAGCTCTGGGCTGCTGTGG + Intergenic
988716060 5:33829487-33829509 CAGCTAGCTGTGTGCTGCTTTGG - Intronic
990081865 5:51926952-51926974 CCTCTAACTTTGGGGTGCTATGG + Intergenic
997424576 5:133794482-133794504 CACCTGAGTGTGGTCTGCTGTGG - Intergenic
999476409 5:151903348-151903370 CACTTAACTGTGAGTTGATAGGG + Intronic
1000986441 5:167865861-167865883 CACTTCACTGTTGGCTGCTATGG - Intronic
1011749675 6:90442624-90442646 TACATCACTGTGGGATGCTAAGG + Intergenic
1013252269 6:108346075-108346097 CCCCTCGCTGTGGGCTACTATGG + Intronic
1014432866 6:121390228-121390250 CACCTCCCTGTGCCCTGCTAAGG - Intergenic
1019738295 7:2661044-2661066 GACCCAACTGTGGGCTCCTGGGG - Intronic
1022904139 7:34839743-34839765 CGCTTAACAGAGGGCTGCTAAGG + Intronic
1024465267 7:49705693-49705715 CTCCTGACTGTGGGCTGTTCTGG - Intergenic
1024675614 7:51635655-51635677 CCCCTTCCTGTGGGCTGCTGGGG + Intergenic
1028916921 7:96269372-96269394 CACCTATGTGTGGGCTGGGATGG - Intronic
1033356041 7:140601396-140601418 CACCTACCTGTGGTCTGCACTGG + Exonic
1033564555 7:142565983-142566005 CACCTAACTGTGGGCTGCTATGG + Intergenic
1033606866 7:142933861-142933883 TTCCTAACTGTGGGCTGGGATGG + Intergenic
1035953938 8:4054830-4054852 CTCCAAACAGTGGGCTGCTGTGG - Intronic
1037374801 8:18216336-18216358 CTCATAACTTTGGGATGCTATGG - Intronic
1045736675 8:105304072-105304094 CACCTTTGTGTGGGTTGCTATGG - Intronic
1047705750 8:127497856-127497878 CCCTGAACTGTGGGCTGCTCCGG - Intergenic
1049775626 8:144402824-144402846 CACCTGTCTGTGGGCTGTTGGGG - Intronic
1058261100 9:102833141-102833163 CTGCTAACTGTGAGCTGCTCAGG - Intergenic
1059785177 9:117574328-117574350 CATCTAACTGTGAGCCGCTGTGG + Intergenic
1187671084 X:21666441-21666463 CACTTCACTGTGGGCTGATTTGG - Intergenic
1190927746 X:54923927-54923949 CACCAATCTGTGAACTGCTAGGG - Intronic
1192304765 X:69947461-69947483 AACATAGCTGTGGGCTGCTGGGG - Intronic
1193179113 X:78432643-78432665 CACTGAACTGTGAGCTCCTAAGG - Intergenic
1200936473 Y:8742747-8742769 CACAGATCTGTGGGCTGCCAGGG - Intergenic