ID: 1033566185

View in Genome Browser
Species Human (GRCh38)
Location 7:142580429-142580451
Sequence TGTTCTCTGCATGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033566181_1033566185 -8 Left 1033566181 7:142580414-142580436 CCAGGGCAGCCACCTTGTTCTCT No data
Right 1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG No data
1033566178_1033566185 30 Left 1033566178 7:142580376-142580398 CCTCACTGGAAATAAAATCTGCA No data
Right 1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033566185 Original CRISPR TGTTCTCTGCATGAGGAGCA TGG Intergenic
No off target data available for this crispr