ID: 1033566720

View in Genome Browser
Species Human (GRCh38)
Location 7:142585925-142585947
Sequence AAGTCTACTCTCACCATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033566720_1033566723 13 Left 1033566720 7:142585925-142585947 CCTTAGATGGTGAGAGTAGACTT No data
Right 1033566723 7:142585961-142585983 AAGTTAAGGATCTGGAGATAAGG No data
1033566720_1033566721 -1 Left 1033566720 7:142585925-142585947 CCTTAGATGGTGAGAGTAGACTT No data
Right 1033566721 7:142585947-142585969 TTACAGATGTGATGAAGTTAAGG No data
1033566720_1033566724 25 Left 1033566720 7:142585925-142585947 CCTTAGATGGTGAGAGTAGACTT No data
Right 1033566724 7:142585973-142585995 TGGAGATAAGGAGATTATTTTGG No data
1033566720_1033566722 5 Left 1033566720 7:142585925-142585947 CCTTAGATGGTGAGAGTAGACTT No data
Right 1033566722 7:142585953-142585975 ATGTGATGAAGTTAAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033566720 Original CRISPR AAGTCTACTCTCACCATCTA AGG (reversed) Intergenic
No off target data available for this crispr