ID: 1033568597

View in Genome Browser
Species Human (GRCh38)
Location 7:142604615-142604637
Sequence ATGTATTAGTAGATGAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033568597_1033568601 7 Left 1033568597 7:142604615-142604637 CCCTCATTCATCTACTAATACAT No data
Right 1033568601 7:142604645-142604667 ACCACATGCCAGTGACAACGGGG No data
1033568597_1033568599 5 Left 1033568597 7:142604615-142604637 CCCTCATTCATCTACTAATACAT No data
Right 1033568599 7:142604643-142604665 TCACCACATGCCAGTGACAACGG No data
1033568597_1033568600 6 Left 1033568597 7:142604615-142604637 CCCTCATTCATCTACTAATACAT No data
Right 1033568600 7:142604644-142604666 CACCACATGCCAGTGACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033568597 Original CRISPR ATGTATTAGTAGATGAATGA GGG (reversed) Intergenic
No off target data available for this crispr