ID: 1033570091

View in Genome Browser
Species Human (GRCh38)
Location 7:142619077-142619099
Sequence CTGTGTGGTCCTTTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033570085_1033570091 9 Left 1033570085 7:142619045-142619067 CCCCTTTGCACTATGAGCAACCA No data
Right 1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG No data
1033570084_1033570091 10 Left 1033570084 7:142619044-142619066 CCCCCTTTGCACTATGAGCAACC No data
Right 1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG No data
1033570086_1033570091 8 Left 1033570086 7:142619046-142619068 CCCTTTGCACTATGAGCAACCAG No data
Right 1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG No data
1033570087_1033570091 7 Left 1033570087 7:142619047-142619069 CCTTTGCACTATGAGCAACCAGG No data
Right 1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG No data
1033570083_1033570091 19 Left 1033570083 7:142619035-142619057 CCAAGAAGGCCCCCTTTGCACTA No data
Right 1033570091 7:142619077-142619099 CTGTGTGGTCCTTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033570091 Original CRISPR CTGTGTGGTCCTTTGTCTCC TGG Intergenic
No off target data available for this crispr