ID: 1033570137

View in Genome Browser
Species Human (GRCh38)
Location 7:142619348-142619370
Sequence TACCGACAGGACCCAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033570129_1033570137 21 Left 1033570129 7:142619304-142619326 CCCTGAGTTGTGAACAGAATTTG No data
Right 1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG No data
1033570132_1033570137 -4 Left 1033570132 7:142619329-142619351 CCACGATGCCATGTACTGGTACC No data
Right 1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG No data
1033570130_1033570137 20 Left 1033570130 7:142619305-142619327 CCTGAGTTGTGAACAGAATTTGA No data
Right 1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033570137 Original CRISPR TACCGACAGGACCCAGGGCA AGG Intergenic
No off target data available for this crispr