ID: 1033571863

View in Genome Browser
Species Human (GRCh38)
Location 7:142637438-142637460
Sequence TCAGGAAATAAGTGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033571857_1033571863 12 Left 1033571857 7:142637403-142637425 CCCTTCTTAGAACACAAACTCAT No data
Right 1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG No data
1033571856_1033571863 23 Left 1033571856 7:142637392-142637414 CCGAATGTTAGCCCTTCTTAGAA No data
Right 1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG No data
1033571858_1033571863 11 Left 1033571858 7:142637404-142637426 CCTTCTTAGAACACAAACTCATT No data
Right 1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033571863 Original CRISPR TCAGGAAATAAGTGTGTAGC AGG Intergenic
No off target data available for this crispr