ID: 1033573438

View in Genome Browser
Species Human (GRCh38)
Location 7:142656717-142656739
Sequence CATGGCATGAAGAGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033573438_1033573449 17 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573438_1033573445 1 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573445 7:142656741-142656763 CCTCCCTGCTCTTCTTCTGTGGG No data
1033573438_1033573451 24 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573451 7:142656764-142656786 GCCTTTTATCTCCTGGGAACAGG No data
1033573438_1033573446 2 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573446 7:142656742-142656764 CTCCCTGCTCTTCTTCTGTGGGG No data
1033573438_1033573450 18 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573450 7:142656758-142656780 TGTGGGGCCTTTTATCTCCTGGG No data
1033573438_1033573443 0 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573443 7:142656740-142656762 GCCTCCCTGCTCTTCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033573438 Original CRISPR CATGGCATGAAGAGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr