ID: 1033573447

View in Genome Browser
Species Human (GRCh38)
Location 7:142656744-142656766
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033573447_1033573449 -10 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573447_1033573457 19 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573457 7:142656786-142656808 GTGAGTTTGGAACACAGATGGGG No data
1033573447_1033573456 18 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573456 7:142656785-142656807 GGTGAGTTTGGAACACAGATGGG No data
1033573447_1033573455 17 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573455 7:142656784-142656806 AGGTGAGTTTGGAACACAGATGG No data
1033573447_1033573451 -3 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573451 7:142656764-142656786 GCCTTTTATCTCCTGGGAACAGG No data
1033573447_1033573450 -9 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573450 7:142656758-142656780 TGTGGGGCCTTTTATCTCCTGGG No data
1033573447_1033573453 6 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573453 7:142656773-142656795 CTCCTGGGAACAGGTGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033573447 Original CRISPR GGCCCCACAGAAGAAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr