ID: 1033573449

View in Genome Browser
Species Human (GRCh38)
Location 7:142656757-142656779
Sequence CTGTGGGGCCTTTTATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033573447_1033573449 -10 Left 1033573447 7:142656744-142656766 CCCTGCTCTTCTTCTGTGGGGCC No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573437_1033573449 20 Left 1033573437 7:142656714-142656736 CCTCCATCCTGCCTCTTCATGCC No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573444_1033573449 -7 Left 1033573444 7:142656741-142656763 CCTCCCTGCTCTTCTTCTGTGGG No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573438_1033573449 17 Left 1033573438 7:142656717-142656739 CCATCCTGCCTCTTCATGCCATG No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573440_1033573449 13 Left 1033573440 7:142656721-142656743 CCTGCCTCTTCATGCCATGGCCT No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573441_1033573449 9 Left 1033573441 7:142656725-142656747 CCTCTTCATGCCATGGCCTCCCT No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data
1033573442_1033573449 -1 Left 1033573442 7:142656735-142656757 CCATGGCCTCCCTGCTCTTCTTC No data
Right 1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033573449 Original CRISPR CTGTGGGGCCTTTTATCTCC TGG Intergenic
No off target data available for this crispr