ID: 1033582915

View in Genome Browser
Species Human (GRCh38)
Location 7:142752861-142752883
Sequence GGCCACCAGAATCACCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 0, 2: 2, 3: 31, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033582915_1033582928 26 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582928 7:142752910-142752932 GGAGTTGTCTCCTGGGGTGATGG 0: 1
1: 0
2: 3
3: 22
4: 233
1033582915_1033582923 5 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582923 7:142752889-142752911 GTCTGCAATGGACAGCTCCAAGG 0: 1
1: 2
2: 2
3: 17
4: 154
1033582915_1033582920 -7 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582920 7:142752877-142752899 GGTGGCCCTGTGGTCTGCAATGG 0: 3
1: 1
2: 2
3: 18
4: 183
1033582915_1033582925 19 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582925 7:142752903-142752925 GCTCCAAGGAGTTGTCTCCTGGG 0: 3
1: 1
2: 2
3: 11
4: 128
1033582915_1033582924 18 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582924 7:142752902-142752924 AGCTCCAAGGAGTTGTCTCCTGG 0: 3
1: 1
2: 1
3: 8
4: 125
1033582915_1033582926 20 Left 1033582915 7:142752861-142752883 CCCCCAGGGTGATTCTGGTGGCC 0: 2
1: 0
2: 2
3: 31
4: 195
Right 1033582926 7:142752904-142752926 CTCCAAGGAGTTGTCTCCTGGGG 0: 3
1: 1
2: 3
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033582915 Original CRISPR GGCCACCAGAATCACCCTGG GGG (reversed) Exonic
901236695 1:7671059-7671081 GGCCATCACACTCACCTTGGGGG - Intronic
902962502 1:19974814-19974836 GGCCACCAGCTGGACCCTGGGGG - Intergenic
903540987 1:24096263-24096285 GGCCACTAAAATCACCCAAGTGG + Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
905323226 1:37132269-37132291 GCCCACCAGAACCCACCTGGTGG - Intergenic
906613496 1:47219689-47219711 GGCCACCAGGATCAGCCAGGAGG - Exonic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
908868258 1:68576596-68576618 GTCCACCAGAAGCACCCTCCTGG - Intergenic
912553114 1:110497201-110497223 GGCCACCAGCATAACTCGGGAGG - Intergenic
913194133 1:116440964-116440986 GGCCACCACAGGCACCATGGGGG + Intergenic
913429153 1:118770425-118770447 GGACACAGGAATCAACCTGGAGG + Intergenic
913452403 1:119001156-119001178 GGCTAACAGAATCACCCTCGGGG - Intergenic
914341615 1:146764901-146764923 GGCCACCAGAGTCATCTCGGAGG - Intergenic
916496989 1:165355681-165355703 GGCGACCAGAATCAGCCAGGAGG + Intronic
917913663 1:179678125-179678147 GGCAGCCATAATCCCCCTGGGGG - Intronic
918143585 1:181737594-181737616 AGCCAGCAGCATCGCCCTGGCGG + Exonic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
921263880 1:213406469-213406491 GGCCACCAGACTTTCCCTGGAGG + Intergenic
923462904 1:234222572-234222594 GCCCACCAGACTCACCAAGGCGG - Intronic
1065195478 10:23260999-23261021 GACCACCAGAATCACACTCGAGG + Intergenic
1066348729 10:34616547-34616569 GGCAACATGAATGACCCTGGAGG + Intronic
1068823888 10:61411100-61411122 GGACCCCAGAATCACAATGGTGG - Intronic
1069929708 10:71874227-71874249 GGCCACCATCATCTCCCAGGTGG + Intergenic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1074866522 10:117547201-117547223 GGCCTCCAGCCCCACCCTGGTGG + Intronic
1075713828 10:124544576-124544598 GGCCAACAGTCTCACCCTGCAGG + Intronic
1075849370 10:125574674-125574696 GGCCACCCGAATCAATCTGTAGG - Intergenic
1077300323 11:1843772-1843794 GGACACCAGAATCACCCGAGAGG - Intergenic
1078427222 11:11261718-11261740 GGGCCCCAGTCTCACCCTGGAGG + Intergenic
1079866370 11:25740509-25740531 GGCGCCAAGAATCACCATGGAGG - Intergenic
1080298777 11:30760334-30760356 GCCCACCAGTATCACGTTGGTGG - Intergenic
1080606495 11:33869172-33869194 AGCCCCCGGAATCACCCGGGAGG + Intronic
1084233869 11:67773530-67773552 GGCCAGCATAATCACCATGTAGG - Intergenic
1086291068 11:85309810-85309832 GGGCACCAGACTCAGCCTGCAGG - Intronic
1088420146 11:109636223-109636245 GGCCACTAGGGTCAGCCTGGTGG + Intergenic
1088835874 11:113577691-113577713 AGCCACCACAATCACCTAGGTGG + Intergenic
1089135690 11:116247238-116247260 GGGCATCAGAATCACCTAGGGGG + Intergenic
1091671911 12:2457973-2457995 GGCCATCTGAGCCACCCTGGAGG + Intronic
1093747594 12:22760942-22760964 GACCACCAGAAACACACTTGCGG - Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1097988517 12:65809781-65809803 GGCTACCAGCATCACCCTCTAGG - Intergenic
1101447940 12:104751196-104751218 GGCCACCTGAATCCCCAGGGAGG - Intronic
1102525644 12:113510603-113510625 GGCCACCAGAATCCCACTGGAGG - Intergenic
1103571792 12:121849763-121849785 GGACACCACACACACCCTGGTGG - Exonic
1105814756 13:24024540-24024562 GGCCACCAGCAGGGCCCTGGTGG - Intronic
1106578410 13:30997420-30997442 GGCCTCCAGAATGCACCTGGTGG + Intergenic
1107387534 13:39928289-39928311 AGCCAGTAGAATCACACTGGTGG + Intergenic
1108321377 13:49294184-49294206 GGTCACCAGAATCACCCGCAAGG - Intergenic
1110992427 13:82059280-82059302 GGTCACAAGAATCAGCCTGAAGG + Intergenic
1112186941 13:97136793-97136815 GGCCCCTAGAATCCCCATGGTGG + Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1115157394 14:30356629-30356651 GACCTCCAGAATCACTCCGGAGG - Intergenic
1118710052 14:68511421-68511443 AGCTCCCAGAATCACCCTAGGGG + Intronic
1119476552 14:74933738-74933760 GTCCACCACAATCTCCCAGGAGG + Intergenic
1120933037 14:89867528-89867550 GGGCTGCAGGATCACCCTGGAGG - Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122265582 14:100545180-100545202 CCCCACCAGCTTCACCCTGGTGG + Intronic
1122468411 14:101949673-101949695 GGCCACCAAAAGGACTCTGGCGG + Intergenic
1122801041 14:104229585-104229607 GGCCACCACAAGCACCCAGGGGG - Intergenic
1123186085 14:106518238-106518260 GGTCACCAGGATCAGCCTTGAGG - Intergenic
1124896592 15:33783132-33783154 GCGCATCAGAATCACCCGGGAGG + Intronic
1127402097 15:58598961-58598983 CCCCACAAGCATCACCCTGGGGG + Intronic
1128319089 15:66680097-66680119 GGAAACCTGAATCCCCCTGGAGG - Intronic
1131465879 15:92654723-92654745 TGCCTCCAGAATTACGCTGGAGG - Intronic
1132475924 16:138226-138248 GCTCACCAGAATCACGCTGATGG + Exonic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133130632 16:3674291-3674313 GGACAACAGAGTCACCCTGAGGG + Intronic
1134594194 16:15482422-15482444 GGCCACCAGAACCATCCAGTGGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1136616875 16:31403790-31403812 GGCAACCAGGAGCACCCCGGGGG - Intronic
1137068927 16:35881611-35881633 AGCCACCACAATCACTCAGGAGG + Intergenic
1137323629 16:47411396-47411418 GGCCACCAGAAGGAGACTGGTGG + Intronic
1138116112 16:54361979-54362001 GGGGAACAAAATCACCCTGGTGG + Intergenic
1139992663 16:70952541-70952563 GGCCACCAGAGTCATCTCGGAGG + Exonic
1140055427 16:71521565-71521587 GGCCACCACTATCTTCCTGGAGG + Intronic
1140111871 16:72011783-72011805 GTCCACCACGATCACCCTAGGGG + Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1141033949 16:80612165-80612187 AGCCAGAAGCATCACCCTGGAGG - Intronic
1141186164 16:81789008-81789030 GCCCATCAGAAACACCCAGGGGG + Intronic
1142270710 16:89088074-89088096 GGCCTCCAGGATGGCCCTGGGGG - Intergenic
1143306106 17:5948069-5948091 GGCAACCATAGTCAGCCTGGAGG + Intronic
1143314440 17:6021723-6021745 GTTCATCAGAATCACCCAGGGGG + Intronic
1144763376 17:17720050-17720072 GGCCACCAGGGACACCCAGGTGG - Intronic
1146473672 17:33144674-33144696 GCCCACAAGAAGCAGCCTGGGGG + Intronic
1147637862 17:41974868-41974890 GGCCTCCAGAGGCACCATGGAGG - Exonic
1148342384 17:46881079-46881101 GCCCACCAGGATCCTCCTGGGGG + Intronic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1148901946 17:50884993-50885015 GGCCACCACACTCACCCAGCAGG + Intergenic
1151767504 17:76139960-76139982 GGCCACCAAGATCACCCTGTCGG - Exonic
1152545488 17:80998173-80998195 TGCCACCAGAATCCCCTAGGTGG - Intronic
1152640586 17:81447664-81447686 GGCCGCCACCATCAACCTGGGGG + Exonic
1152900756 17:82939741-82939763 GGCCACCAGACACAGCCTTGTGG - Intronic
1153975381 18:10264182-10264204 TCCCACCAGAATCAGCCTGCGGG + Intergenic
1154171238 18:12052737-12052759 AGCCACCACAATCACTCAGGAGG + Intergenic
1154249215 18:12729032-12729054 AGGCACAAGAATCACCCAGGAGG + Intergenic
1155958657 18:31975371-31975393 GCACACCAGCATCAGCCTGGGGG - Intergenic
1157567434 18:48689088-48689110 GGCCTTCAGACACACCCTGGAGG + Intronic
1158251807 18:55498014-55498036 GGCCACGTGTGTCACCCTGGTGG - Intronic
1160774197 19:847694-847716 GGCCACCTGAGTCTCCCGGGAGG - Intronic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161373055 19:3924335-3924357 GGCAACCTCAATCAGCCTGGAGG - Intronic
1161568409 19:5016418-5016440 GGCCACCACCTTCTCCCTGGCGG - Intronic
1161988930 19:7673009-7673031 GGCCACCAGCATCAGACAGGGGG - Intergenic
1162329869 19:10021246-10021268 GGTCGCCAGCATCTCCCTGGTGG + Exonic
1164547512 19:29181224-29181246 GGCCACCTGCACCACACTGGCGG + Intergenic
1165861401 19:38911355-38911377 GGCCACCAGCAACACCCTTGTGG - Intronic
1166147995 19:40850397-40850419 GGCCACCAGAAGCATCCCTGAGG + Exonic
1166152137 19:40882181-40882203 GGCCACCAGAAGCAGCCCTGAGG + Exonic
1166171017 19:41027693-41027715 GGCCACCAGAAGCAGCCCTGAGG + Intergenic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1168319751 19:55501666-55501688 GGCCAGCAGAATCAGCCTCCAGG + Intronic
926411894 2:12613372-12613394 GGCTACCAGAAACACACAGGTGG + Intergenic
927954912 2:27201372-27201394 GCCCACCACAATCACTGTGGTGG + Exonic
928306853 2:30177423-30177445 GGCCACCATAATAACCCTGAAGG - Intergenic
934938375 2:98481424-98481446 GGCAACCAGAATAAAACTGGAGG - Intronic
935213868 2:100960697-100960719 GGCCACCAGCAGCACCAAGGTGG + Intronic
935483835 2:103627900-103627922 GGCCATGTGAATGACCCTGGAGG + Intergenic
941110805 2:161417261-161417283 CCCCACCAACATCACCCTGGCGG - Intronic
941446907 2:165612721-165612743 GGCCACATGAATGAACCTGGAGG - Intronic
946399532 2:219461170-219461192 GGGCACCAGAGTCAGCCTTGGGG - Intronic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
948767678 2:240231937-240231959 GACCAACAGTACCACCCTGGAGG + Intergenic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1171336335 20:24388985-24389007 GTACACAAGAACCACCCTGGGGG + Intergenic
1172146545 20:32762150-32762172 GGCCAGTGAAATCACCCTGGGGG - Intergenic
1172186017 20:33031537-33031559 GGACCCCAGAAACACCCAGGGGG + Intergenic
1176385530 21:6137137-6137159 GGCCCCCAGAAACAACCTTGGGG + Intergenic
1178859847 21:36279536-36279558 GGCCACCAGCAGCCCTCTGGGGG - Intronic
1179737943 21:43401115-43401137 GGCCCCCAGAAACAACCTTGGGG - Intergenic
1183126445 22:35786517-35786539 AGATACCAGAAGCACCCTGGGGG + Intronic
1183447731 22:37869823-37869845 GGCCACCAGAAACACCACAGGGG - Intronic
1183516258 22:38268283-38268305 AGGCACGAGAATCACCCAGGAGG + Intronic
1184522215 22:45001463-45001485 GGCCACCAGGCTCACCCAGGTGG - Intronic
952968563 3:38636622-38636644 GCCCACCAGGAGCAGCCTGGGGG - Intronic
953352638 3:42227518-42227540 GCACACCAGAATCACCTTGAGGG - Intergenic
957117962 3:76050602-76050624 GGCCACGAGAACCAGCCTGTGGG - Intronic
958095785 3:88942706-88942728 GGCCACCAGAAAAACCAAGGTGG + Intergenic
961150671 3:124635091-124635113 GGCCACCAACATCACCTAGGAGG - Intronic
962411831 3:135147557-135147579 GGGCAGCAGCATCACTCTGGGGG + Intronic
963272174 3:143296357-143296379 GGCAACAAGAATGAACCTGGAGG - Intronic
963605578 3:147409839-147409861 GGCCGGCAGAATCTGCCTGGCGG + Exonic
964034729 3:152181978-152182000 GGCCACCATACCAACCCTGGAGG - Intergenic
964683735 3:159370832-159370854 GGCCTTCAGAATCAGACTGGGGG + Intronic
965641594 3:170834618-170834640 GTGCACCAGAATCACCTTGAGGG - Intronic
967254297 3:187574004-187574026 GGCCACCTGGATCAGCCTTGGGG + Intergenic
967778168 3:193406165-193406187 GGGCATCAGAATCACCTGGGAGG - Intronic
968816570 4:2824606-2824628 AGCCGCCCGCATCACCCTGGGGG - Exonic
969051420 4:4375971-4375993 GTGCATCAGAATCTCCCTGGAGG + Intronic
969821281 4:9722229-9722251 GGCCAGCATAATCACCATGTGGG + Intergenic
979483271 4:121242327-121242349 CACCAGCAGAATCACACTGGAGG + Intergenic
983552425 4:169031536-169031558 GGCCACCACACGCACCCTGGAGG + Intergenic
983552436 4:169031570-169031592 GGCCACCGCACGCACCCTGGAGG + Intergenic
983552447 4:169031604-169031626 GGCCACCGCACGCACCCTGGAGG + Intergenic
984825124 4:183917247-183917269 ATCCACCACAATCACCCTGGTGG - Intronic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
986313059 5:6568846-6568868 GGCCATTAGAATCACCCGAGTGG - Intergenic
986479600 5:8173207-8173229 GGTCACCAGCATCACCCCAGGGG - Intergenic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
988949307 5:36241574-36241596 GGCCACCACCACCACCCGGGAGG + Exonic
989568506 5:42924475-42924497 GGCCACCGGGCTCAGCCTGGAGG + Intergenic
990281101 5:54251810-54251832 GCACAATAGAATCACCCTGGAGG + Intronic
990370205 5:55110014-55110036 GGCTTCCAGAATCTCCCTGGAGG - Exonic
991911980 5:71571561-71571583 GAGCATCAGAATCACCTTGGAGG + Intergenic
992263127 5:74990545-74990567 AAGCACCAGAAGCACCCTGGAGG - Intergenic
992750729 5:79858074-79858096 GGCCACCAGCATCAACATGCAGG + Intergenic
993176449 5:84492193-84492215 GGACCCCAGAATCATGCTGGAGG + Intergenic
994087893 5:95780267-95780289 GGCCACCAGGATGGCCCTGTGGG - Exonic
994188172 5:96838349-96838371 TGGCACCAGAATCTCCCTGAGGG - Intronic
999327259 5:150650936-150650958 AGCCAGCAGAAGGACCCTGGAGG - Exonic
999365057 5:151017998-151018020 GGCAATCAGAAGCAGCCTGGTGG + Intergenic
999768258 5:154756322-154756344 GGCGACCAGGATCAACCAGGAGG - Intronic
1001764363 5:174233669-174233691 CACCACCAGAGTCCCCCTGGGGG - Intronic
1001929052 5:175659661-175659683 TACAACCAGAAGCACCCTGGAGG - Intronic
1006434792 6:34020464-34020486 TGCTGCCAGAGTCACCCTGGGGG + Intronic
1006610343 6:35290900-35290922 GGCCAGCAGAAGGAGCCTGGAGG + Intronic
1006730060 6:36230092-36230114 GGCCAGCTGAGCCACCCTGGAGG - Intronic
1007909996 6:45504078-45504100 GGCTACCAGAATCATCCAGCAGG - Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1016181297 6:141151198-141151220 GGCCATGAGAATCACCATGTTGG + Intergenic
1019496907 7:1345057-1345079 GGACACCACACTCATCCTGGGGG + Intergenic
1020268290 7:6576606-6576628 GGCCACCTGGATCCCCCTGCTGG + Intergenic
1022088922 7:27095456-27095478 CGCCCCCAGCATAACCCTGGTGG + Exonic
1022748931 7:33203271-33203293 GTCTACCAGAATCACCTGGGAGG + Intronic
1023863417 7:44228089-44228111 GGCCAGCAGCCTCTCCCTGGAGG - Intronic
1024780095 7:52837638-52837660 GGCCACCAGGAACACACTTGAGG + Intergenic
1029800970 7:102947236-102947258 TGACAACAGAATCACACTGGAGG + Intronic
1031890430 7:127287546-127287568 GGCCACCAGAGTCAGACAGGTGG + Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1033605862 7:142928243-142928265 GGCCCCCTGACTCATCCTGGTGG - Intronic
1034400471 7:150858443-150858465 GGCCACCAGGACCACACGGGCGG + Intronic
1036149515 8:6284583-6284605 GATCACCAGACTCACCCTGAAGG - Intergenic
1039922805 8:41905163-41905185 GGCCTGCAGACTCACCCTGGTGG - Intergenic
1040340662 8:46438902-46438924 GGCCACCAGAAACAGCCCTGTGG + Intergenic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1040749238 8:50685326-50685348 GGACACCATTATTACCCTGGAGG - Intronic
1041920218 8:63173884-63173906 GGCCACAAGAAGCAACCTGAAGG - Intronic
1042935463 8:74053832-74053854 AGCCACCAGTCTCACCATGGGGG - Intergenic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1046819898 8:118622577-118622599 AGCCACCTGAACCACCCTGTAGG - Intergenic
1046975534 8:120271960-120271982 GGCCACCATGATCACTCTGCTGG - Intronic
1047690527 8:127348969-127348991 GGGCACCAGAATCACCCAGAGGG - Intergenic
1047739025 8:127792624-127792646 GCCCACCAGCATCCCCCAGGAGG + Intergenic
1048197428 8:132343627-132343649 AGCCACCAGCAGCACCTTGGTGG - Intronic
1049987861 9:969629-969651 GGCCACTAGAAACACCTTGGAGG - Intergenic
1056070716 9:82983851-82983873 AGCCACGAGAAGCACCCTGGTGG + Intronic
1056679466 9:88704652-88704674 GGCCATCAGAATCAGCCCTGGGG + Intergenic
1056809326 9:89752179-89752201 TGCCACCAGGGTCAGCCTGGTGG - Intergenic
1060247161 9:121956816-121956838 GGGCACCAGAATCACCTGGTGGG - Intronic
1062156539 9:135052037-135052059 GGCCTCCAGAAGCAGCCAGGTGG - Intergenic
1062633256 9:137476960-137476982 GGCCAGCAGAAGCATCCTCGAGG + Intronic
1187267457 X:17747997-17748019 GGCCATCAGAATCACCTGGGGGG + Intronic
1187707687 X:22024289-22024311 GGGCACCAGAATCTCCCGGAGGG - Intergenic
1187832177 X:23393449-23393471 GGCCACCAAAAACATTCTGGAGG - Exonic
1189430023 X:40938059-40938081 GACCATCAGAATGACCCTGCTGG + Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1191902361 X:66054024-66054046 CACCATCAGAATCACCCTAGGGG + Intergenic