ID: 1033584605

View in Genome Browser
Species Human (GRCh38)
Location 7:142764806-142764828
Sequence TGGGACTCCTTAAAAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033584602_1033584605 4 Left 1033584602 7:142764779-142764801 CCTTTGAGATACTTCAAGTGACT No data
Right 1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033584605 Original CRISPR TGGGACTCCTTAAAAAAAAG TGG Intergenic
No off target data available for this crispr