ID: 1033585941

View in Genome Browser
Species Human (GRCh38)
Location 7:142774349-142774371
Sequence GGCCACCAGAATCACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033585941_1033585946 -7 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585946 7:142774365-142774387 GGTGGCCCTGTGGTCTCCAATGG 0: 1
1: 3
2: 0
3: 23
4: 211
1033585941_1033585952 19 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585952 7:142774391-142774413 GCTCCAAGGAATTGTCTCCTGGG 0: 1
1: 3
2: 1
3: 13
4: 119
1033585941_1033585949 5 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585949 7:142774377-142774399 GTCTCCAATGGAGAGCTCCAAGG 0: 1
1: 0
2: 1
3: 19
4: 140
1033585941_1033585953 20 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585953 7:142774392-142774414 CTCCAAGGAATTGTCTCCTGGGG 0: 1
1: 3
2: 2
3: 17
4: 155
1033585941_1033585955 26 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585955 7:142774398-142774420 GGAATTGTCTCCTGGGGCTATGG 0: 1
1: 2
2: 2
3: 18
4: 171
1033585941_1033585951 18 Left 1033585941 7:142774349-142774371 CCCCCAGGGTGATTCTGGTGGCC No data
Right 1033585951 7:142774390-142774412 AGCTCCAAGGAATTGTCTCCTGG 0: 1
1: 3
2: 0
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033585941 Original CRISPR GGCCACCAGAATCACCCTGG GGG (reversed) Intergenic
No off target data available for this crispr