ID: 1033586047

View in Genome Browser
Species Human (GRCh38)
Location 7:142775081-142775103
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 4, 1: 1, 2: 0, 3: 28, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033586047_1033586050 7 Left 1033586047 7:142775081-142775103 CCTAGTTCCATCTCTGTGAGCAG 0: 4
1: 1
2: 0
3: 28
4: 207
Right 1033586050 7:142775111-142775133 AGATGTTCCACCTACCACAGCGG No data
1033586047_1033586055 26 Left 1033586047 7:142775081-142775103 CCTAGTTCCATCTCTGTGAGCAG 0: 4
1: 1
2: 0
3: 28
4: 207
Right 1033586055 7:142775130-142775152 GCGGGAGCCAGACTGCGACTTGG No data
1033586047_1033586051 8 Left 1033586047 7:142775081-142775103 CCTAGTTCCATCTCTGTGAGCAG 0: 4
1: 1
2: 0
3: 28
4: 207
Right 1033586051 7:142775112-142775134 GATGTTCCACCTACCACAGCGGG No data
1033586047_1033586056 27 Left 1033586047 7:142775081-142775103 CCTAGTTCCATCTCTGTGAGCAG 0: 4
1: 1
2: 0
3: 28
4: 207
Right 1033586056 7:142775131-142775153 CGGGAGCCAGACTGCGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033586047 Original CRISPR CTGCTCACAGAGATGGAACT AGG (reversed) Intergenic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
903623862 1:24717361-24717383 TTGTTCACAGAGATGGGAATGGG - Intergenic
903778950 1:25809691-25809713 CGGCTCACTGAGCTGGAACTCGG - Exonic
903801196 1:25969700-25969722 CTGCTAGCAGACATGGAAATGGG - Intronic
903814047 1:26051713-26051735 CTGCTCAGAGAGCAGGGACTAGG - Exonic
905878841 1:41450516-41450538 CAGATCACAGAGATGCCACTCGG - Intergenic
906196965 1:43935645-43935667 GTGTTGATAGAGATGGAACTTGG + Exonic
906999731 1:50838652-50838674 CTGCTCCCACAGATGTTACTGGG + Intronic
907729804 1:57054879-57054901 CAGCTCCCTGAGATGGAAATTGG + Intronic
907938431 1:59063873-59063895 CTGCTGACAAAGAAGGAATTTGG + Intergenic
908388894 1:63667831-63667853 TTTCTCACAGTTATGGAACTGGG + Intergenic
910262426 1:85305308-85305330 CAGCTCACAGAGACCGTACTGGG - Intergenic
912738562 1:112172544-112172566 CTACACTCAGAGATGGAACAAGG + Intergenic
914450656 1:147788449-147788471 CAGCTCAGAAGGATGGAACTGGG + Intergenic
914898896 1:151701362-151701384 CAGCTCACAGAGAAGAATCTAGG + Intergenic
919126293 1:193397170-193397192 CTGCTCACAAAGTTGGCTCTTGG + Intergenic
919920358 1:202163505-202163527 CGGCTCACAGCCCTGGAACTGGG - Intergenic
920073221 1:203318252-203318274 GGGCTCACAGAAATGGCACTGGG + Intergenic
920711853 1:208302854-208302876 CTGCTCACAGGGGTGGAGTTGGG + Intergenic
922147938 1:222967290-222967312 AGGCTAACAGAGATGCAACTGGG - Intronic
1063140309 10:3250902-3250924 GAGCACACAGAGATGGAGCTGGG + Intergenic
1064256396 10:13746089-13746111 CAGCTCAGAGAGATGAAATTAGG + Intronic
1064284946 10:13984029-13984051 CTCCTCACTCAGCTGGAACTAGG + Intronic
1065848131 10:29763124-29763146 CCGCTCACAGAGAGGAAACCAGG + Intergenic
1065963223 10:30750969-30750991 CTGGACTCAGAGATGGACCTGGG - Intergenic
1066816160 10:39416943-39416965 CAACTCACAGAGTTGAAACTTGG + Intergenic
1067056432 10:43055024-43055046 CCGCTCACTGACTTGGAACTTGG + Intergenic
1067477145 10:46574584-46574606 CTCCTCACAAAGAAGGACCTGGG + Intergenic
1067617594 10:47767197-47767219 CTCCTCACAAAGAAGGACCTGGG - Intergenic
1070715517 10:78718186-78718208 TTGCTCACAGTTCTGGAACTGGG - Intergenic
1070719346 10:78745498-78745520 CTCTTCACAGAGAAGCAACTGGG + Intergenic
1072412477 10:95216322-95216344 CTGCTCACTGTGATGGTATTTGG - Intronic
1072739997 10:97903533-97903555 CTGCTTACAGGGAAGGGACTTGG + Intronic
1074388686 10:113038083-113038105 CTGCTCCCAGAGAAGGTATTTGG + Intronic
1074647571 10:115477592-115477614 CTGCTCGAAGATATGGGACTTGG + Intronic
1076325942 10:129623229-129623251 CTGTTCACAGTGATGTGACTGGG - Intronic
1077158876 11:1103637-1103659 CTCCTCACAGAGACTGAACCCGG - Intergenic
1085871687 11:80357733-80357755 CTCCTCACATTGATGGGACTGGG - Intergenic
1090168046 11:124572006-124572028 CATTTCACAGATATGGAACTTGG + Intergenic
1091679067 12:2513280-2513302 CTGCCCAAAGAGGTGGAACCTGG - Intronic
1092239012 12:6826344-6826366 CTACTTACAGGTATGGAACTGGG + Exonic
1096729192 12:53593459-53593481 CTGCTCAAAGAGTTGTGACTGGG - Intronic
1096747788 12:53739592-53739614 CTGCGCTCAGAGCTGGGACTCGG - Intergenic
1100236293 12:92664637-92664659 CTGGCCACAGCGAGGGAACTTGG - Intergenic
1101021512 12:100558877-100558899 CGGCTGAGAGAGGTGGAACTAGG - Intronic
1101523403 12:105505647-105505669 CTGATCACAAAGATGGCACCTGG + Intergenic
1103990054 12:124792942-124792964 CTGCTAACTGGGATGCAACTGGG - Intronic
1106500247 13:30321519-30321541 GTCCTCATAGAGATAGAACTTGG - Intergenic
1107112983 13:36717585-36717607 ATGTACACAGAAATGGAACTGGG + Intergenic
1107451873 13:40517117-40517139 CTGCACGAAGAGATGGAAATTGG + Intergenic
1109525331 13:63567132-63567154 CAGCTCCCACAGATGGCACTGGG - Intergenic
1111571866 13:90099436-90099458 CTGTTCAGAGAGATGTAACTAGG + Intergenic
1113817227 13:113181365-113181387 TTGATCACAGAAATGAAACTGGG - Intronic
1114127813 14:19750742-19750764 CTCCTCACAGACTAGGAACTAGG + Intronic
1119553925 14:75539165-75539187 CTGCTTAGAGAGAAGGAGCTTGG - Intronic
1119828732 14:77681644-77681666 CTGCTTACAAAGATGGTCCTTGG + Intronic
1123571262 15:21612192-21612214 CTCCTCACAGACTAGGAACTAGG + Intergenic
1123607376 15:22047544-22047566 CTCCTCACAGACTAGGAACTAGG + Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1129206882 15:74042499-74042521 CTGCTCAGAAAGATGAAATTAGG + Intronic
1130844667 15:87733663-87733685 CTGCTCAGAGCAAGGGAACTTGG + Intergenic
1130854157 15:87826234-87826256 CTGCACACAGAGGTGGAAGGCGG - Intergenic
1202979613 15_KI270727v1_random:339318-339340 CTCCTCACAGACTAGGAACTAGG + Intergenic
1133118656 16:3592896-3592918 CTGATCAGAGAGTTGTAACTTGG + Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1140417857 16:74789308-74789330 CTTGTCAGAGAAATGGAACTGGG - Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1145063671 17:19747931-19747953 CTGCTGACAGAGATGCATGTGGG - Intronic
1145891038 17:28415981-28416003 CTTCTCTCAAAGGTGGAACTGGG + Intergenic
1146645840 17:34577134-34577156 CTGCTCAGAGAGAAGGCAGTTGG - Exonic
1146682814 17:34820812-34820834 CTTCTGACAGAGATAAAACTGGG + Intergenic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1149159125 17:53668763-53668785 CTGCTAACAAAGATGGACCCAGG - Intergenic
1152946181 17:83198828-83198850 CTGCCCACAGAGTAGGAAGTGGG - Intergenic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1154980341 18:21498405-21498427 CTGCTCTCAGAGAGAAAACTGGG - Intronic
1155866066 18:30966372-30966394 AAGCTCTCAGAGGTGGAACTTGG + Intergenic
1156609832 18:38713045-38713067 CTGCTCAGGGAGATGGAATAAGG - Intergenic
1157271720 18:46281368-46281390 CTCCTGCCAGAGACGGAACTAGG - Intergenic
1158744361 18:60181489-60181511 TTGCTCACAGAGATGAAAAATGG - Intergenic
1160134531 18:76261312-76261334 CTGCACACAGCGGTGGAACAGGG - Intergenic
1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG + Intronic
1163257880 19:16168478-16168500 CTGCTCCAAGAGCTGGAAGTTGG - Intronic
1163323551 19:16588578-16588600 ATGCTCTCAGAGGAGGAACTGGG - Intronic
1164711431 19:30359660-30359682 CTGCCCACAAGGATGGAACTTGG - Intronic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1166595050 19:44039611-44039633 CTGGCCTCAGAGAAGGAACTAGG - Intergenic
925031853 2:655924-655946 TTGCTCACAGATCTGTAACTTGG - Intergenic
925701840 2:6646600-6646622 CTGCTCAAAGTGATTGAAATGGG - Intergenic
927140400 2:20126361-20126383 CAGCACTCAGAGATGGAGCTGGG - Intergenic
927475425 2:23410895-23410917 TTGAGTACAGAGATGGAACTTGG + Intronic
927877313 2:26666871-26666893 CTGAGCACAGAGAGGAAACTAGG + Intergenic
928744731 2:34398454-34398476 AAGAACACAGAGATGGAACTAGG + Intergenic
929220515 2:39460180-39460202 CTGCTCACAGGGATGTAAATTGG + Intergenic
929879510 2:45823764-45823786 ATGCCCTCAGAGGTGGAACTGGG - Intronic
931051706 2:58423044-58423066 CTGCTCAAAGAGATGTGTCTGGG + Intergenic
933311873 2:80670640-80670662 CTGCTCACAATGATAGAGCTTGG - Intergenic
936076793 2:109406399-109406421 CTGCTCTCAGTGATGGACCTGGG - Intronic
937182593 2:120009988-120010010 CTCCTATCAAAGATGGAACTGGG - Intergenic
939581245 2:143948878-143948900 CTTCTCACAGAGATAAAACAGGG - Intronic
942808606 2:179967985-179968007 AAGCTCACAGAGATGGATATAGG - Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
944624630 2:201558735-201558757 TGGCTCACAGAGGTGGATCTGGG - Intronic
944655775 2:201875324-201875346 CTGCTGGCAGAAATGGAAATTGG + Intronic
944711540 2:202339269-202339291 CTACTCACACAGATATAACTAGG + Intergenic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
948329854 2:237156348-237156370 CTGCCCACAGACAGGGAACCGGG + Intergenic
1169360670 20:4946207-4946229 CTGGTTTCTGAGATGGAACTTGG - Intronic
1170429292 20:16261789-16261811 CTGCTCACAGAGGAGGAAAAAGG + Intergenic
1170926336 20:20727798-20727820 ATGGCCACAGGGATGGAACTGGG + Intergenic
1172415876 20:34767248-34767270 CTGATCATAGAATTGGAACTAGG - Intronic
1178713501 21:34942175-34942197 GTGCTCACAGTGATAGAATTTGG + Intronic
1179581038 21:42344158-42344180 CTGCTCCCGGAGTTGGCACTGGG - Intergenic
1179622537 21:42626710-42626732 TTGCTCACAGAGCTGGAGCCTGG - Intergenic
1179933232 21:44585942-44585964 CTTCTCACAGAGCTGACACTGGG + Intronic
1180857333 22:19056817-19056839 CTGGTCACAGAGCTGCAAATGGG + Intronic
1181926291 22:26361733-26361755 GTGCTCACAGACATACAACTAGG + Intronic
1181937581 22:26449728-26449750 CTACTGAGAGAGAGGGAACTGGG + Intronic
1183056508 22:35309895-35309917 CTGGCCACAGAGATGGAAGCGGG - Intronic
951177549 3:19619040-19619062 CTGCACACAGAGTTGCCACTGGG - Intergenic
952002521 3:28802732-28802754 CTGCTTACAGAGGAGGATCTTGG + Intergenic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
953981776 3:47416974-47416996 CTGCTCACAGGTGTGGAGCTGGG + Intronic
954424652 3:50437009-50437031 CTGCACACAGACATGGTGCTTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954680920 3:52345510-52345532 CTGCTCCCAGAAGTGGTACTTGG - Exonic
954946009 3:54424929-54424951 TTGCTCACAGAGCTGGACGTGGG + Intronic
955196186 3:56806749-56806771 CTGCTCCCAGTCATGGGACTGGG - Intronic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
955463134 3:59207773-59207795 CAGCTCCCAGTGATGGAGCTTGG + Intergenic
957438247 3:80208295-80208317 GTGATCATAGAGATAGAACTTGG - Intergenic
962885076 3:139617153-139617175 CTGTTCACACTGATGGCACTGGG + Intronic
964793257 3:160472482-160472504 CTGACCACAGAGGTGGAACCAGG + Intronic
967222615 3:187260401-187260423 TGGCTCAAAGAGAAGGAACTGGG + Intronic
967760937 3:193225771-193225793 GTGCTCAGGGAGATGGAACTTGG + Intergenic
967941071 3:194767320-194767342 CAGCCCAAAGAGGTGGAACTGGG + Intergenic
968746015 4:2360606-2360628 CTGCTCACAGTGAGGGGTCTGGG - Intronic
970810253 4:20084760-20084782 GGGCTCACAGAGGTAGAACTTGG + Intergenic
973692946 4:53458012-53458034 CTGCCCACACAGATGTAATTAGG + Intronic
975159479 4:71109448-71109470 CTGATCACAGAGATGCAACAGGG - Intergenic
982778375 4:159465507-159465529 CTGCTCACTGACATTGATCTTGG - Intergenic
986139721 5:5018176-5018198 CTGTTCAGAGAAATGGAACAAGG - Intergenic
988791505 5:34612338-34612360 CTGCTGACAGGGATGGAGATTGG + Intergenic
990211188 5:53482649-53482671 CTGATCACAGAGATGGGAGGTGG - Intronic
992604838 5:78444698-78444720 CTGCTCACAGAAGTGGCATTAGG - Intronic
992779568 5:80115754-80115776 CTGGACTCAGAGATGCAACTGGG - Intronic
995486763 5:112647553-112647575 CTCCTCACAGCCATGGAATTTGG + Intergenic
997891437 5:137680512-137680534 CTGCTCACAGAACTGGACTTTGG - Intronic
998961750 5:147495190-147495212 CTGGTCTCAGAGAAGGAGCTGGG - Intronic
1000020208 5:157311693-157311715 CTGCTCGCAGATATTGTACTGGG - Exonic
1001408187 5:171491375-171491397 CTGGTCTCAGAGATGGTACTAGG + Intergenic
1001760837 5:174206793-174206815 CAGCTCACAGGGGTGGTACTGGG - Intronic
1001891775 5:175345380-175345402 CTGCTTCCAGAGCTGGAACCAGG - Intergenic
1001911863 5:175526633-175526655 CTTGTCACAGACATGGAACTGGG - Exonic
1002037755 5:176485892-176485914 CTTTTCAGAGAGATGGAGCTTGG + Intronic
1002939717 6:1705436-1705458 CTGCTCAGAAAGATGGGATTAGG - Intronic
1006148409 6:31972584-31972606 CGGCTCACGGACAGGGAACTGGG - Intronic
1007157421 6:39758759-39758781 CTGCTCAGAAAAATGGCACTGGG + Intergenic
1007735755 6:43981391-43981413 TTCCTCACTGAGCTGGAACTTGG + Intergenic
1008808778 6:55466356-55466378 TAGCTCAAAGAAATGGAACTTGG - Intronic
1014159744 6:118154208-118154230 TTGCTCACAGTCATGTAACTAGG - Intronic
1015545460 6:134356895-134356917 CTTTTCACAGACATGGAGCTGGG + Intergenic
1015810560 6:137158303-137158325 CAGCTGATAGAGATGGCACTGGG - Intronic
1016636918 6:146303221-146303243 CTTCTCACAGAGAAGGGACTGGG - Intronic
1018963489 6:168465681-168465703 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963496 6:168465725-168465747 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963504 6:168465770-168465792 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963511 6:168465814-168465836 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963518 6:168465859-168465881 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963526 6:168465904-168465926 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963534 6:168465949-168465971 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963541 6:168465994-168466016 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963548 6:168466039-168466061 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963556 6:168466084-168466106 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963564 6:168466129-168466151 CTACTCTGAGAGCTGGAACTGGG + Intronic
1018963580 6:168466262-168466284 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963594 6:168466348-168466370 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1019924242 7:4181790-4181812 CTGCTCACAGAGCTCGAAGGCGG + Intronic
1020338113 7:7080179-7080201 CTGATCATAGAGAAGGAAATGGG + Intergenic
1020564828 7:9781941-9781963 CTGCTCTGAATGATGGAACTCGG + Intergenic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1023081171 7:36527857-36527879 TTACCCACAGAGATGGATCTGGG + Intronic
1023495173 7:40787807-40787829 TTGCTGACAGAGGTGGAAGTGGG - Intronic
1024252421 7:47516601-47516623 CTGCTTACTGAGTTGGAGCTGGG - Intronic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026534657 7:71229793-71229815 CTTGTCACAGACATCGAACTAGG - Intronic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1029299802 7:99571665-99571687 CTGCTCATAGAGAAGGAAATGGG - Intronic
1030087746 7:105831404-105831426 CAGCCCACAGAGTTGGAAATTGG - Intronic
1031969397 7:128053378-128053400 CATCTCACAGAGCTGGAACAGGG - Intronic
1032479881 7:132237728-132237750 CTTCTCACAGTGATGGCACGAGG - Intronic
1033455069 7:141495744-141495766 CAACACACAGAGATGGACCTTGG - Intergenic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1034348132 7:150399343-150399365 CTGCATACAGAGAAGGATCTGGG - Intronic
1036462859 8:8969526-8969548 CTGTTCTAAAAGATGGAACTTGG + Intergenic
1036508618 8:9379731-9379753 CTGCACCCAGAGATGGCCCTCGG + Intergenic
1037206378 8:16325287-16325309 CTGCTCACAGACCTTGATCTGGG + Intronic
1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG + Intronic
1037618936 8:20546049-20546071 CTGGTCAAAGAGATGGAAACAGG + Intergenic
1038786012 8:30617138-30617160 CTGCTCAATGTGAGGGAACTTGG - Intronic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1040483968 8:47853165-47853187 CTCCTCACACAGACGGCACTGGG - Intronic
1042373693 8:68022456-68022478 CTGCTGACAGAGCTGTAAGTAGG + Intronic
1046561547 8:115843880-115843902 CTGCTCTCAGTGGTGGAACATGG - Intergenic
1047785427 8:128149907-128149929 TTGCTCCCAGAGTAGGAACTTGG - Intergenic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1049287077 8:141781658-141781680 CAGGTCACAGAAATGGAGCTGGG - Intergenic
1049988807 9:974249-974271 CTGCAAACAGAAATGGGACTCGG + Intergenic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1055322967 9:75100203-75100225 CTGCTCACAGAGACAGAAGAAGG - Intronic
1056674001 9:88657618-88657640 CTGCGGACAGACATGGGACTAGG - Intergenic
1056829192 9:89900722-89900744 CTGATCACAGCTAGGGAACTTGG - Intergenic
1057744885 9:97742932-97742954 CTGCTTACAGAGATGCAGCAAGG - Intergenic
1058592840 9:106583810-106583832 CTGCTGGCAGAGATGGGAGTGGG - Intergenic
1059470149 9:114498813-114498835 ATGCTCAAGGAGATGGAACTGGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1059882735 9:118709695-118709717 CTTGTCACAGAGATGGTAATAGG - Intergenic
1060844020 9:126820525-126820547 CTGCTCATTGAGAAGGCACTTGG + Intronic
1186086010 X:5991520-5991542 CTGCTGAGTGAGATGGAAATAGG + Intronic
1186257523 X:7738621-7738643 TTGAGCACAGAGATGGAAATAGG + Intergenic
1186457676 X:9722818-9722840 AAGATGACAGAGATGGAACTGGG + Intergenic
1187210341 X:17224256-17224278 CTTCTCACAGAGAGGGAAGGTGG + Intergenic
1190051010 X:47148544-47148566 CTGCCCACAGAGGTGGGAATTGG - Intronic
1190335070 X:49257358-49257380 CTGCTCACAGCCAAGGATCTGGG + Intronic
1191182505 X:57578316-57578338 CTGCCCACAGCAAAGGAACTTGG - Intergenic
1191634258 X:63359330-63359352 CGGGTCACAAACATGGAACTTGG + Intergenic
1191755904 X:64592077-64592099 CTGCTCACAGACATCGAAGAGGG + Intergenic
1194736482 X:97518154-97518176 CTGCTCACTGCCATGGAACATGG + Intronic
1195264490 X:103166593-103166615 TTGCTCACAGGGATGGAAAATGG - Intergenic
1197830360 X:130635471-130635493 ATCCTCACAGAAATTGAACTTGG - Intronic
1198426513 X:136526128-136526150 CTGTGCACAGAGTTGGAACATGG + Intergenic
1200837126 Y:7743015-7743037 TTGCTCACAGATCTGCAACTTGG - Intergenic