ID: 1033591190

View in Genome Browser
Species Human (GRCh38)
Location 7:142809699-142809721
Sequence CCTGCTCTGCAGGAGCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033591180_1033591190 24 Left 1033591180 7:142809652-142809674 CCCCCAAAGTAAGTAGTGGGAAA No data
Right 1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG No data
1033591181_1033591190 23 Left 1033591181 7:142809653-142809675 CCCCAAAGTAAGTAGTGGGAAAT No data
Right 1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG No data
1033591183_1033591190 21 Left 1033591183 7:142809655-142809677 CCAAAGTAAGTAGTGGGAAATTA No data
Right 1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG No data
1033591182_1033591190 22 Left 1033591182 7:142809654-142809676 CCCAAAGTAAGTAGTGGGAAATT No data
Right 1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG No data
1033591186_1033591190 -2 Left 1033591186 7:142809678-142809700 CCAGGTATATAATAGGTCAAGCC No data
Right 1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033591190 Original CRISPR CCTGCTCTGCAGGAGCTCAA GGG Intergenic
No off target data available for this crispr