ID: 1033595744

View in Genome Browser
Species Human (GRCh38)
Location 7:142856598-142856620
Sequence CACTCTAGGTAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033595735_1033595744 -5 Left 1033595735 7:142856580-142856602 CCCTAGACCCTGAGTTCCCACTC 0: 1
1: 0
2: 0
3: 11
4: 177
Right 1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG No data
1033595733_1033595744 7 Left 1033595733 7:142856568-142856590 CCTGAGCCTGGGCCCTAGACCCT 0: 1
1: 0
2: 1
3: 34
4: 323
Right 1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG No data
1033595736_1033595744 -6 Left 1033595736 7:142856581-142856603 CCTAGACCCTGAGTTCCCACTCT 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG No data
1033595734_1033595744 1 Left 1033595734 7:142856574-142856596 CCTGGGCCCTAGACCCTGAGTTC 0: 1
1: 0
2: 1
3: 15
4: 172
Right 1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033595744 Original CRISPR CACTCTAGGTAGAAGGAGGA TGG Intronic
No off target data available for this crispr