ID: 1033597943

View in Genome Browser
Species Human (GRCh38)
Location 7:142869997-142870019
Sequence CAACCTGGGAGGGATCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033597943_1033597956 30 Left 1033597943 7:142869997-142870019 CCACCCCGATCCCTCCCAGGTTG 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1033597956 7:142870050-142870072 GTTTGTATTCTAAGATCTCATGG 0: 1
1: 0
2: 0
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033597943 Original CRISPR CAACCTGGGAGGGATCGGGG TGG (reversed) Intronic
900477850 1:2884304-2884326 CCACATGGGAGGGATGGGGCTGG - Intergenic
900548537 1:3241982-3242004 CTGCCTGGGAGTGATCGTGGGGG + Intronic
901311054 1:8269966-8269988 TACCCTGGCAGGGAGCGGGGAGG - Intergenic
901936377 1:12629916-12629938 AAACCTGGGAGGACTCTGGGAGG - Intergenic
902288962 1:15424453-15424475 CAACCTGGCAGAGACAGGGGTGG - Intronic
902471456 1:16649535-16649557 CAACCTGGGAGGGTGTGAGGTGG + Intergenic
903037085 1:20499931-20499953 CCACTTGGGAGAGCTCGGGGTGG - Exonic
903772744 1:25774207-25774229 CCAGCTGGGATGGACCGGGGAGG + Intronic
903856705 1:26342166-26342188 CAAGATGGGAGGGAACGTGGGGG - Intronic
903973271 1:27133001-27133023 CTTCCTGGGAGGGAGCAGGGTGG + Intronic
904038619 1:27571722-27571744 CAGCCTGGGAGGGGGAGGGGAGG - Intronic
904042503 1:27592799-27592821 TAACCTGTGAGGGCTGGGGGTGG + Intronic
905360760 1:37418624-37418646 CAACCTGGCAGGGAGACGGGTGG - Intergenic
907581239 1:55574603-55574625 CAACCTCGGAGGGAATGGAGGGG + Intergenic
911995372 1:104758957-104758979 CTACCTGGGCAGGATTGGGGTGG - Intergenic
912937383 1:114015400-114015422 AAACCAGGCAGGGGTCGGGGTGG + Intergenic
914730260 1:150363914-150363936 AAAACTGGGAGGGATGGGTGAGG - Intronic
914871004 1:151473610-151473632 CAACCCGGGAGGGAGCGGCGAGG + Intergenic
915141711 1:153772199-153772221 CAGCCTGGGAGGGCTGGGGTTGG - Intronic
915368823 1:155330967-155330989 CAACTTGGGAGGGATGGAGTGGG - Exonic
915965648 1:160305621-160305643 TAGACTGGCAGGGATCGGGGTGG + Intronic
915971780 1:160360332-160360354 CAAACTGGGAGGGTTGGGGTGGG - Intergenic
920345873 1:205305328-205305350 CCACCTGAGAGAGATGGGGGAGG + Exonic
920559164 1:206926662-206926684 AAAGCTGGGAGGGATGGGGTGGG + Intergenic
922498985 1:226083282-226083304 CGACCTGGGGGGGAGGGGGGAGG - Intergenic
922499110 1:226083707-226083729 CAGCCCGGGAGGGAACGGCGGGG - Intergenic
1063120339 10:3101460-3101482 CAACCTGTGTGTGATCGGCGGGG + Exonic
1063305373 10:4894352-4894374 CAAACTGGGAGGGAACTGAGAGG + Intergenic
1063973656 10:11398264-11398286 CTGCCTGGGAGGGATCTGGGAGG + Intergenic
1066551197 10:36559465-36559487 CACCCTGGAAGAGGTCGGGGTGG - Intergenic
1070565887 10:77603578-77603600 CATCCTGGCAGGCATCTGGGAGG + Intronic
1070593711 10:77818188-77818210 CAACCTGGGTGGGCCTGGGGAGG + Intronic
1070850733 10:79559880-79559902 CAGCCTGGGAGGGACAGGGCAGG - Intronic
1075341434 10:121649532-121649554 CCACCAGGCAGGGATGGGGGTGG - Intergenic
1077023637 11:430482-430504 CAGCAGGGGAGGGATGGGGGAGG + Intronic
1077034028 11:486284-486306 CATGCGGGGAGGGGTCGGGGTGG + Intronic
1077362942 11:2148821-2148843 CAAAATGGGAGGGGTAGGGGAGG - Intronic
1077365381 11:2159414-2159436 GAACCTGGGAGGGCTAGGTGGGG + Intronic
1077407004 11:2387138-2387160 CAGCCAGGGAGGGCTGGGGGTGG + Intronic
1079668497 11:23136142-23136164 CTACCTGGGACAGATCTGGGTGG - Intergenic
1080725785 11:34898669-34898691 CACTCTGGGTGGGAGCGGGGAGG - Intronic
1081902883 11:46644501-46644523 CAAACTGTGAGGTATGGGGGCGG + Intronic
1083472929 11:62896324-62896346 CACCCTGGGTGGGATGTGGGTGG + Intergenic
1083639296 11:64136673-64136695 CGACCTGTGAGGGACCCGGGTGG + Intronic
1083659587 11:64245927-64245949 CAACCAGGGAGTCATGGGGGTGG + Intronic
1084177164 11:67428915-67428937 CAACCTGAACGGGAGCGGGGAGG + Intronic
1084759055 11:71256712-71256734 CATCCAGGGAGGGATGGGGCCGG + Intergenic
1085395884 11:76206871-76206893 CAACCTGGGACGGAAAGGAGAGG + Intronic
1085402828 11:76244720-76244742 CAGCCTGGTAGGGGTCGGGGTGG - Intergenic
1085455923 11:76665337-76665359 CAGCCTGGGAGGGGCTGGGGAGG + Intronic
1088746333 11:112807848-112807870 CAAACTGGGAGAGAGCGGGTGGG + Intergenic
1089566038 11:119372349-119372371 CAACCTGGGCTGGATGCGGGGGG - Intronic
1090997204 11:131877534-131877556 CATCCTGGGTGGAATAGGGGTGG - Intronic
1091704384 12:2683943-2683965 CATGCTGGGAGGGGTCGGTGAGG - Intronic
1094198731 12:27776649-27776671 GAACCTGGGAGGCCTCTGGGAGG + Intergenic
1095657471 12:44687003-44687025 CAAACTGCAAGGGCTCGGGGAGG - Intronic
1096642607 12:53006380-53006402 GAAGCTGGGAGGGGGCGGGGAGG - Exonic
1096781771 12:53995985-53996007 GAACCAGGGAGGGGGCGGGGAGG + Intronic
1104811180 12:131621237-131621259 CATCCTGGGAGTGACTGGGGAGG - Intergenic
1107011925 13:35678570-35678592 AAACCTGGTAGGGAAAGGGGTGG + Intergenic
1112186098 13:97129025-97129047 AAAGCTGGGAGGGATCTTGGAGG + Intergenic
1112508385 13:99988972-99988994 CAGCCGGGCAGGGATAGGGGTGG - Intergenic
1112975289 13:105309742-105309764 CAGCCTGGGAGGAAGTGGGGTGG + Intergenic
1113508337 13:110832031-110832053 CATCCAGGGAGGGAGCTGGGAGG + Intergenic
1117804108 14:59472471-59472493 CAGCCTGGGAAGGATGGGGCTGG - Intronic
1119202904 14:72771625-72771647 CAGCCTGGGTAGGATCGGGGTGG - Intronic
1121244344 14:92451381-92451403 CACCCTGGGTGGGACTGGGGAGG + Intronic
1121386859 14:93535734-93535756 CATCCTGGCAGAGATCTGGGAGG + Intronic
1121415934 14:93779385-93779407 CAGCCTGGCAGGGGACGGGGTGG - Intronic
1122783523 14:104153645-104153667 CATCCTGGGAGGGGTGGGCGGGG + Intronic
1124460846 15:29890182-29890204 GAAACTGGGAGGGGACGGGGTGG + Intronic
1126464829 15:48952099-48952121 CAAGCTGAGAGGGATGTGGGAGG + Intronic
1128752329 15:70158493-70158515 CACTCTGGGAGGGAGTGGGGAGG - Intergenic
1132348585 15:101123086-101123108 CCACCTGGGAGGGCTGGCGGAGG + Intergenic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1138329611 16:56203129-56203151 TAAGCTGGGAGGGAACTGGGTGG + Intronic
1139884140 16:70196876-70196898 CAGCCTGGGAGGGAAGAGGGAGG + Intergenic
1140368378 16:74398620-74398642 CAGCCTGGGAGGGAAGAGGGAGG - Intergenic
1142766123 17:2065254-2065276 ATGCATGGGAGGGATCGGGGAGG - Intronic
1143125108 17:4636862-4636884 CAGCCCAGGAGGGATTGGGGAGG - Intronic
1146653388 17:34620999-34621021 CAGTCTGGCAGGGGTCGGGGAGG + Intronic
1147178456 17:38671120-38671142 CAACCTGGAAGGGGGCGGGGTGG - Intergenic
1147191290 17:38739517-38739539 GAGCGTGGGAGGGATGGGGGAGG + Intronic
1147337757 17:39737701-39737723 CCACCTGGGAGGGAGGGGGGAGG - Intergenic
1147715811 17:42507528-42507550 CAACTTTGGTGGGATCAGGGTGG + Exonic
1147716084 17:42509605-42509627 CTACCTGGCAGGGATGGGTGGGG + Intronic
1148442733 17:47720149-47720171 CAACCTGGGAGGCAGGAGGGTGG + Intergenic
1148641656 17:49192473-49192495 CAAGCTAGGAGGGCTCTGGGCGG - Intergenic
1148723053 17:49768663-49768685 CAGCCTGAGAGGGATTGGGAAGG + Intronic
1149433855 17:56617018-56617040 CAACCTGGGAGAGTTGGGGTGGG + Intergenic
1150287221 17:63961177-63961199 CAACCTGGTAGGGAGGGGCGGGG - Exonic
1151817626 17:76479006-76479028 CAATCTGGAAGGGAGGGGGGCGG + Exonic
1152278665 17:79372564-79372586 CATCCTGGCAGGGATCTGGGGGG - Intronic
1152393812 17:80019441-80019463 CAATCTGGGAGGGGCGGGGGGGG - Intronic
1152747757 17:82049113-82049135 TAACCTGGGAGGGAAGGGTGTGG + Exonic
1153144920 18:2020224-2020246 GAACCTGGTAGGGATCATGGAGG + Intergenic
1156456892 18:37299855-37299877 CAGCGTGGGAGAGATGGGGGTGG - Intronic
1157703122 18:49777865-49777887 CAAGCTAGAAGGGATTGGGGGGG - Intergenic
1159083021 18:63756589-63756611 CATCCTGGTAGAGATCAGGGTGG + Intronic
1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG + Intronic
1162440543 19:10689413-10689435 CAACGTGGACGGGATGGGGGCGG - Exonic
1162982714 19:14249332-14249354 GAACCTCGGAGGGTTCTGGGGGG - Intergenic
1165362548 19:35345750-35345772 CACCCTGGGAGGGAGGCGGGAGG + Intronic
1165490152 19:36118760-36118782 CAAGGTGGGAGGGAGCGCGGTGG + Intronic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166768476 19:45266206-45266228 CAATCTGGGAGGGAAGGGGAAGG - Exonic
1166783030 19:45352170-45352192 CAGCCTGGGAGGGTGCCGGGAGG + Intronic
1168019000 19:53595175-53595197 CAACTTGGAAGGGGTTGGGGGGG + Intergenic
925136480 2:1527165-1527187 CACAGTGGGAGGGATAGGGGAGG - Intronic
925138089 2:1533632-1533654 CAAACTGGAAGGGATGGGGGAGG - Intronic
925138777 2:1536402-1536424 CAAACTGGAAGGGATGGGGGAGG - Intronic
926004957 2:9366346-9366368 CAAACTAGGAGGCATCAGGGTGG + Intronic
926871110 2:17418279-17418301 CAGCCTGGGAAGGATGGGGGAGG + Intergenic
927703284 2:25281609-25281631 CAACCTGGCAGGGCCCTGGGAGG + Intronic
928323665 2:30303104-30303126 TCAGCTGGGAGGGATCGGGTGGG - Intronic
928425048 2:31170923-31170945 CAACCTGAGAGGGCCAGGGGAGG - Intergenic
929798918 2:45082809-45082831 CAGCATGGAAGGGGTCGGGGAGG + Intergenic
930952482 2:57159995-57160017 CAACCTTGGAAGGATAGGGAAGG - Intergenic
932254550 2:70273087-70273109 CTCCCTGGGAGGGGGCGGGGTGG - Intronic
932844901 2:75125012-75125034 CAGCCAGGAAGGGATCGAGGAGG - Intronic
933773546 2:85758621-85758643 CAACCAGGAAGGGAGCAGGGAGG + Intronic
937315979 2:120932368-120932390 GATCCTGAGAGGGAACGGGGAGG - Intronic
944903515 2:204239808-204239830 CACTCTGGAAGGGATCTGGGAGG - Intergenic
947229633 2:227871778-227871800 CAGACTGGGAGGGTTTGGGGCGG + Intronic
949035967 2:241815879-241815901 CAGCCTGGGAGGACTCAGGGCGG + Intronic
1172167468 20:32907842-32907864 CCACCTGGGAGGAATGGGAGGGG + Intronic
1173966663 20:47117494-47117516 CACCCGCGGAGGAATCGGGGAGG - Intronic
1174996666 20:55577440-55577462 CAAACTGGGAGGGACAGTGGAGG - Intergenic
1175225046 20:57439735-57439757 AAACCTGAGCGGGATGGGGGTGG + Intergenic
1176198081 20:63846745-63846767 AACCCTGGGAGGGGTGGGGGCGG - Intergenic
1178945731 21:36946151-36946173 GAACCTGGCAGGGAATGGGGAGG + Intronic
1179498478 21:41790745-41790767 GAATCGGGGAGGGATGGGGGAGG + Intergenic
1180927417 22:19565964-19565986 CAACGGGGGAGGGATGGGGCGGG - Intergenic
1181703091 22:24631908-24631930 CAGCTGGGGAGGGAGCGGGGAGG + Intergenic
1182144460 22:27988755-27988777 CAGCCACGGAGGGGTCGGGGCGG - Intronic
1183351260 22:37336028-37336050 CACCCTGGAAGAGATGGGGGTGG - Intergenic
1183947402 22:41334458-41334480 CAGCCTGGCAGGGACTGGGGGGG - Intronic
1184047660 22:41981613-41981635 CAAGGTGGGAGGGGTCGGAGGGG - Intronic
1184190008 22:42888118-42888140 GAGCCTGGGTGGGATCAGGGAGG - Intronic
1184224060 22:43118935-43118957 CAACCTGGGAGGGGCTTGGGAGG + Intronic
1185102814 22:48850599-48850621 CCACCTGGGAGGGAAGGGGCAGG + Intronic
1185176069 22:49327681-49327703 CAAGCTGGGAGGGAGCTGAGGGG + Intergenic
950455771 3:13091915-13091937 CAGCTTGGGTGGGGTCGGGGTGG + Intergenic
950967543 3:17156462-17156484 CAAACTAGGAGGGATGGGGAGGG - Intergenic
952012944 3:28922123-28922145 AAACCTGGGAAGGATAGTGGGGG + Intergenic
953761910 3:45695058-45695080 CAACCAGGGAGGGCTCAGTGAGG + Intronic
954297972 3:49684706-49684728 CAACCTGGGAGGGTGTGAGGTGG - Intronic
954424394 3:50435760-50435782 GAAGCCGGGAGGGATGGGGGTGG - Intronic
954619455 3:51987203-51987225 CAGCCTGGGAGGCAGTGGGGTGG + Intronic
956422780 3:69101860-69101882 GATCCTGGGAGGAATCGTGGTGG + Exonic
958479285 3:94626453-94626475 CCACATGGAAGGGATGGGGGTGG - Intergenic
958700478 3:97582409-97582431 TAAACTGGGAGGACTCGGGGAGG + Intronic
959573621 3:107910964-107910986 CAACCTGGGAGGAAGGGGGCGGG - Intergenic
961491094 3:127257318-127257340 CCAGGTGGGAGGGATTGGGGAGG - Intergenic
961633390 3:128317865-128317887 CCACCTGGCAGGGAACTGGGAGG - Intronic
963572667 3:147016824-147016846 GAATTTGGGAGGGGTCGGGGTGG + Intergenic
964494504 3:157273617-157273639 CATTCTGGGAGGGAGCAGGGTGG + Intronic
967094913 3:186169768-186169790 CTACCTGGGAGGGTTTGAGGAGG - Intronic
968457665 4:707203-707225 CCACCTGGCAGGGCCCGGGGGGG + Intronic
968659610 4:1793636-1793658 CAGCCAGGGAGGGAAGGGGGAGG + Intronic
968894124 4:3388743-3388765 GAGCCTGGGCGGGGTCGGGGTGG + Intronic
971358561 4:25915844-25915866 CAACTTGGGATGGGGCGGGGGGG + Intronic
972746885 4:41942667-41942689 CAACCTGGCAGAAATTGGGGTGG + Intronic
976478347 4:85510619-85510641 GAACCTGGGAAGGACAGGGGAGG - Intronic
978618204 4:110615883-110615905 CAGCCTGGTAGGGGGCGGGGAGG - Intergenic
985472221 5:53463-53485 GAACCTCGGAGCGCTCGGGGCGG + Intergenic
991438243 5:66618019-66618041 CATTCTGGGAGGAATGGGGGGGG + Intronic
994366908 5:98928141-98928163 GAGCCTGGGAGGGCGCGGGGCGG - Intronic
994464503 5:100109535-100109557 AGATTTGGGAGGGATCGGGGTGG + Intergenic
997129554 5:131263732-131263754 AAACCTGGGCGGGAGCGTGGGGG - Intronic
1001282699 5:170398753-170398775 GAGGCTGGGAGGGATTGGGGTGG - Intronic
1001518831 5:172376531-172376553 CAACCTGGGAGAGAGCAGTGAGG + Intronic
1001734701 5:173988907-173988929 CCACCTCGCAGGGATGGGGGTGG - Intronic
1001962713 5:175889778-175889800 CAACCTGCAAGGGGTGGGGGGGG - Intergenic
1002161039 5:177314283-177314305 CAGTCTGGGTGGGATAGGGGTGG + Intergenic
1002169985 5:177369535-177369557 CAAGCAGGGAGTGATCAGGGAGG + Intronic
1002199294 5:177518271-177518293 CAACCTGGGAGGGATGGAGGAGG + Intergenic
1002449556 5:179310981-179311003 CAACCTGGGGTGGAAAGGGGCGG - Intronic
1003525509 6:6893479-6893501 AAACCTTGGACGGATCGGGCTGG - Intergenic
1005379427 6:25218259-25218281 CTCCCTGGGAGGGAGTGGGGTGG - Intergenic
1005906082 6:30262106-30262128 CAACCTGTGAGAGGTCAGGGAGG - Intergenic
1005942134 6:30568540-30568562 CAACCTGGGCGGGAGGTGGGAGG - Intergenic
1005995724 6:30930188-30930210 CAAACTGGGAGGGAGCTGAGAGG + Intergenic
1006150193 6:31982953-31982975 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006156494 6:32015691-32015713 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006914952 6:37588078-37588100 GAGCCAGGGAGGTATCGGGGTGG + Intergenic
1007264680 6:40587548-40587570 CAATCTGGGAGGGAGTCGGGCGG + Intergenic
1007648113 6:43398350-43398372 AATCCTGGGTGGGCTCGGGGTGG - Intergenic
1009735895 6:67675353-67675375 CCAGCTGGGAGGGAACGGTGTGG + Intergenic
1014349577 6:120323696-120323718 CGTCCTGGGAGGGATCTGGTGGG - Intergenic
1017223531 6:151993705-151993727 CAACCTGGGAGGAAGCAGAGTGG + Intronic
1017326140 6:153143384-153143406 CAGGGTGGGAGGGATCAGGGAGG + Intergenic
1017328925 6:153172959-153172981 CCATCTGGGAGGCATCTGGGAGG - Intergenic
1017933230 6:158978903-158978925 CAATCTGAGATGGATCAGGGAGG + Intronic
1019310331 7:357321-357343 GGACCTGTGAGGGATCCGGGAGG + Intergenic
1019708278 7:2506856-2506878 GAACCTGGGAGGGAGGGGCGAGG + Intergenic
1025803592 7:64809498-64809520 CATCCTGGGAGGGAGGTGGGGGG - Intronic
1026235062 7:68520313-68520335 CAACATGGGAGGGAGGGGAGAGG - Intergenic
1027823722 7:83083564-83083586 CAACTTGGGAGTCATCAGGGAGG - Intronic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1031890361 7:127287088-127287110 CTACCTGGGAGAGACTGGGGTGG + Intergenic
1033597943 7:142869997-142870019 CAACCTGGGAGGGATCGGGGTGG - Intronic
1033705650 7:143882910-143882932 CAGCCTGGGAGGAAGTGGGGAGG - Intronic
1034216745 7:149413502-149413524 CTACCTGGGGGGGAGGGGGGAGG + Intergenic
1036607607 8:10321474-10321496 CACCCTGGGAGGGAGGTGGGAGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037994371 8:23341860-23341882 CTGCCTGGCAGGGATCAGGGAGG + Intronic
1038596265 8:28889673-28889695 CCTCCTGGGAGGGATGGGGTGGG + Intronic
1039197860 8:35052366-35052388 AAATTTGGGAGGGGTCGGGGTGG - Intergenic
1039843949 8:41312464-41312486 CCACCTGGGAGGCACCTGGGGGG - Intergenic
1047811146 8:128410392-128410414 CAAACTGGGAGGAATGGGGGTGG - Intergenic
1049326943 8:142026468-142026490 CAGCCTGGGTGGGATAGGGCTGG - Intergenic
1049780430 8:144426291-144426313 CAGCCTGGGAGGCCTCAGGGAGG - Intronic
1049879772 8:145053621-145053643 GAACCTGGGAAGCAGCGGGGAGG + Intronic
1056592449 9:87974410-87974432 CATCCTGGGCCGCATCGGGGAGG - Exonic
1057316343 9:93971302-93971324 AGATTTGGGAGGGATCGGGGTGG - Intergenic
1057759853 9:97863328-97863350 GAAGCTGGGAGGGTTCTGGGTGG - Intergenic
1058880081 9:109278227-109278249 GAACCCGGGAGGGTTCGAGGAGG + Intronic
1058958358 9:109969850-109969872 CATCCTGGTGGGGTTCGGGGAGG - Intronic
1059329939 9:113528603-113528625 CCACCTGGGAGGCATCTGGGAGG - Intronic
1059339290 9:113588367-113588389 CAGCCTGGGCTGGATCGGAGAGG + Intronic
1060206677 9:121686487-121686509 GAACCTGGCAGGGACTGGGGTGG - Intronic
1060683331 9:125585271-125585293 CAACCTGGAAGGGAACGGGAGGG - Intronic
1060813619 9:126623691-126623713 CAGCCTGGGAGGGGTGGGGAGGG + Intronic
1061714454 9:132510071-132510093 CAAGCAGGGAGGGCTCAGGGAGG + Intronic
1188325412 X:28796250-28796272 AAATCTGGGAGGGGCCGGGGTGG - Intronic
1188450448 X:30302984-30303006 ACACCTGGGAAGGCTCGGGGAGG + Intergenic
1189213122 X:39301355-39301377 CAACCTGGTAGGGAGGGTGGAGG + Intergenic
1193698845 X:84739978-84740000 CAATTTGGGAGAGATCGGAGAGG - Intergenic
1195702641 X:107716551-107716573 CATCCTGGGAAGGGGCGGGGGGG - Intronic
1196927683 X:120649712-120649734 CAAGGTGGGAGGGATCGCCGGGG - Intergenic
1199698969 X:150362911-150362933 CAGCTGGGGAGGGATCGGAGGGG - Intronic
1201896414 Y:18997290-18997312 CAACCTGGCAGGGGTCTGGGTGG + Intergenic