ID: 1033599176

View in Genome Browser
Species Human (GRCh38)
Location 7:142876699-142876721
Sequence GAGGGGAGCTGGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033599176_1033599187 8 Left 1033599176 7:142876699-142876721 CCTGCAGCATCCCAGCTCCCCTC 0: 1
1: 1
2: 5
3: 54
4: 611
Right 1033599187 7:142876730-142876752 AGCTCTTACCCAGGGAGTCCTGG 0: 2
1: 0
2: 0
3: 26
4: 178
1033599176_1033599188 9 Left 1033599176 7:142876699-142876721 CCTGCAGCATCCCAGCTCCCCTC 0: 1
1: 1
2: 5
3: 54
4: 611
Right 1033599188 7:142876731-142876753 GCTCTTACCCAGGGAGTCCTGGG 0: 2
1: 0
2: 0
3: 19
4: 156
1033599176_1033599183 -1 Left 1033599176 7:142876699-142876721 CCTGCAGCATCCCAGCTCCCCTC 0: 1
1: 1
2: 5
3: 54
4: 611
Right 1033599183 7:142876721-142876743 CCCCATCTCAGCTCTTACCCAGG 0: 1
1: 1
2: 0
3: 39
4: 233
1033599176_1033599185 0 Left 1033599176 7:142876699-142876721 CCTGCAGCATCCCAGCTCCCCTC 0: 1
1: 1
2: 5
3: 54
4: 611
Right 1033599185 7:142876722-142876744 CCCATCTCAGCTCTTACCCAGGG 0: 1
1: 1
2: 1
3: 22
4: 179
1033599176_1033599189 14 Left 1033599176 7:142876699-142876721 CCTGCAGCATCCCAGCTCCCCTC 0: 1
1: 1
2: 5
3: 54
4: 611
Right 1033599189 7:142876736-142876758 TACCCAGGGAGTCCTGGGCCCGG 0: 1
1: 0
2: 1
3: 22
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033599176 Original CRISPR GAGGGGAGCTGGGATGCTGC AGG (reversed) Intronic
900339115 1:2179500-2179522 GTGGGGAGCTGGGACCATGCTGG - Intronic
900422809 1:2562927-2562949 GAGGGGAGGTGGGAAGGTGGAGG - Intronic
900688100 1:3961987-3962009 GAGAGGAGCTGGGGTGCAGGAGG + Intergenic
901380720 1:8872033-8872055 GAGGGGACTTGGGATTGTGCTGG - Intronic
901462054 1:9397819-9397841 AAGAGGAGGTGGGCTGCTGCAGG + Intergenic
901861828 1:12079446-12079468 GAGGGGAGCTGGGATGTGCTCGG - Intronic
902091149 1:13904191-13904213 GAGGTGCCCTGGGATGCTGGAGG + Intergenic
902409315 1:16203597-16203619 GAGGGAAGTTGGGATGTTGAAGG - Intronic
902602882 1:17551989-17552011 AGGAGGAGCTGGGCTGCTGCTGG + Intronic
903275373 1:22218149-22218171 GAGGGGAGTTGGGCTGCTGGGGG + Intergenic
903983868 1:27210534-27210556 GAGCAGAGCTGCGATGTTGCAGG - Intergenic
904039918 1:27577751-27577773 GAGGGGAGCAGGGTGGCAGCTGG - Intronic
904094907 1:27969004-27969026 GAGAGGATCTGAGATGATGCTGG + Intergenic
904385633 1:30140353-30140375 GAGGGGTGCTGGGAGGAAGCTGG + Intergenic
904528860 1:31155161-31155183 GAGGGGAGTTGGGAAGGGGCTGG + Intergenic
904840777 1:33370545-33370567 TTGAGGAGCTGGGCTGCTGCTGG + Exonic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
905179141 1:36155987-36156009 GAGAGGCGCCGGGAGGCTGCGGG + Intronic
905368933 1:37472467-37472489 GATGTGAGCTGGCATGCAGCAGG + Intergenic
905522593 1:38612036-38612058 GAGGGCAGCTGAGATGATCCTGG - Intergenic
905569419 1:38991722-38991744 AAAGGGAACTGGGATGCCGCTGG + Intronic
906611772 1:47208768-47208790 GAGGGGAGGTGGGAGGCTGTTGG - Intergenic
906919517 1:50048514-50048536 GAGTGGCGCGGGGCTGCTGCGGG - Intronic
907333220 1:53684763-53684785 TAGGGGTGCTGGGAGCCTGCTGG - Intronic
908066998 1:60416747-60416769 GAAGGGAGGTGGGATGGTGGTGG + Intergenic
910163971 1:84303414-84303436 GGGGGGAGAAGGGAGGCTGCTGG - Intronic
910354561 1:86340658-86340680 GAGGGCAGCTGGGAAGATGGCGG - Intergenic
911091778 1:94022900-94022922 GAGGGAGGCTGGGAGGCAGCAGG + Intronic
912238560 1:107880423-107880445 GAGGGGAGCTGGGATGTCCATGG + Intronic
912431989 1:109632853-109632875 GGGGGAGGCTGGGAGGCTGCTGG + Intergenic
913335720 1:117707766-117707788 GAGGAGGTCTGAGATGCTGCTGG + Intergenic
915475443 1:156150242-156150264 GAGGGGACCTGGGAAGCTCTGGG + Intronic
915580089 1:156808369-156808391 GAGGGGCTCAGGGATGCTGGGGG + Intronic
916428524 1:164705156-164705178 TGGGGGAGTGGGGATGCTGCTGG - Intronic
916730570 1:167563077-167563099 GAGGGGAGCTTCGAGGCTGTTGG + Intergenic
916850048 1:168694605-168694627 ATGGGGAGCTGGGAGGGTGCAGG - Intergenic
917688924 1:177447730-177447752 GAGGAGAGTTGGGAAGTTGCTGG - Intergenic
917887190 1:179398363-179398385 GGGGGGAGCTGAGGTGCTCCTGG + Intronic
917978349 1:180254330-180254352 CAGGGGAGCTGTGCGGCTGCTGG + Intronic
919802343 1:201361447-201361469 AAGGAGGGCTGGGATGCTGGGGG - Intronic
920214307 1:204351146-204351168 CCGAGCAGCTGGGATGCTGCTGG + Intronic
920297512 1:204967999-204968021 GAGGGAAGCTGGGCTCCTCCAGG + Intronic
921167009 1:212514785-212514807 GGCGGGGGCTGGGAGGCTGCGGG - Intergenic
922154626 1:223031390-223031412 TTTGGGAGCTGGGAAGCTGCAGG + Intergenic
922154640 1:223031469-223031491 TTTGGGAGCTGGGAAGCTGCAGG + Intergenic
922221225 1:223610009-223610031 GCGGGGAGGTGGGAGGCTGTTGG + Intronic
922234728 1:223713742-223713764 AAGGTGACCTGGGAGGCTGCTGG - Intronic
922516295 1:226210665-226210687 GAGGGGGGATGGGATGCGGGAGG - Intergenic
922564246 1:226590830-226590852 GCAGGGAGCTGGGAAGCTGATGG - Intronic
922726673 1:227926030-227926052 CAGGAGTGCTGGGAAGCTGCAGG - Intronic
923522687 1:234748163-234748185 GAGTGGAGATGGGAGGCGGCGGG - Intergenic
924920947 1:248628405-248628427 CGGGGGAGCCCGGATGCTGCAGG + Intergenic
1063614986 10:7593409-7593431 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615005 10:7593475-7593497 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615024 10:7593541-7593563 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615034 10:7593574-7593596 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615044 10:7593607-7593629 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615054 10:7593640-7593662 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615064 10:7593673-7593695 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615073 10:7593706-7593728 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063960445 10:11301565-11301587 GAGGGGAGGTGGGCTTCTCCAGG + Intronic
1064308404 10:14188960-14188982 GAGGTGAGCTGGGTTGCTCAGGG - Intronic
1065267073 10:23987777-23987799 GAGAGGAGCTGGGAAGATGTTGG - Intronic
1065311107 10:24416716-24416738 GAGGGAAGATGGCTTGCTGCAGG - Intronic
1066196647 10:33106699-33106721 GAGGGGAGCTGGAAAGATGATGG - Intergenic
1066268812 10:33801937-33801959 GAAGGGTGATGTGATGCTGCTGG - Intergenic
1066745809 10:38603784-38603806 CCGGGGAGCTGGGGAGCTGCGGG - Intergenic
1067090719 10:43264747-43264769 GAGGGGCGCTGGGCTGCTGGGGG - Intronic
1069832084 10:71287679-71287701 GAGTGGAGCGGGGTTGGTGCAGG - Exonic
1069838129 10:71322138-71322160 GAGGGAAACTGGGATGGTGGGGG - Intronic
1069895751 10:71679168-71679190 GAGGGGAGCAGGGCGTCTGCTGG + Intronic
1069903703 10:71720151-71720173 GAGGGGAGCAGGGAGAGTGCTGG + Intronic
1070746200 10:78935575-78935597 CAGGGGAGCTGGGGTGGTGGGGG - Intergenic
1071523768 10:86346662-86346684 TCGGGAAGCTGGGCTGCTGCTGG - Intronic
1072238503 10:93473609-93473631 GAGGGGAGCTGACATGATTCTGG + Intronic
1072546726 10:96445761-96445783 GAGCGGGGCTGGCGTGCTGCTGG - Intronic
1072548285 10:96457293-96457315 GAGGGAGGCTGGGGTGCAGCAGG - Intronic
1072749727 10:97969178-97969200 GATTGGAGCTGGGATGGTACAGG - Intronic
1072805072 10:98418959-98418981 GAGGAAAGCTGGGAGCCTGCAGG + Intronic
1073113864 10:101079932-101079954 GAAGGGAGTGGGGAGGCTGCAGG - Intergenic
1073304530 10:102492586-102492608 GAGGGAAGCAGGCATGTTGCTGG - Intronic
1073315725 10:102579408-102579430 CAGGGGAGGTGGGAGGCTGGCGG - Intronic
1074325596 10:112447500-112447522 GGGGAGAGCTGGGAGGGTGCGGG + Intronic
1074335736 10:112572990-112573012 GTGGTGAGATGGGATGCTTCAGG - Intronic
1074921677 10:118020592-118020614 GAGCGGTGCTGGGATGGGGCTGG - Intronic
1074964228 10:118474521-118474543 GATGGCAGCTGGGATGATCCTGG - Intergenic
1075268319 10:121025560-121025582 GAGGGGAGCAGGGAGGCTCTCGG + Intergenic
1075344283 10:121670834-121670856 GCAGGGAGGTGGGCTGCTGCAGG - Intergenic
1075686178 10:124366869-124366891 GCTGGGAGCTGGGATGGTGGTGG - Intergenic
1075816885 10:125271473-125271495 GGGGAGAGCTGGGAGGCTCCTGG + Intergenic
1076532743 10:131155574-131155596 GAGGAAAGCTGGGACACTGCTGG - Intronic
1076821302 10:132941304-132941326 CAGGGGAGCTGGGGTGGGGCGGG - Intronic
1076999503 11:315696-315718 CAGGGGAGCAGGGAAGATGCCGG - Intergenic
1077032258 11:473824-473846 GGAGGGAGGTGGGAGGCTGCAGG - Intronic
1077062362 11:623496-623518 GAGCGGGGCTGGGATGCAACAGG + Intronic
1077179147 11:1204410-1204432 AAGGGGACCTGGGAGGCTCCTGG + Intergenic
1077214901 11:1391125-1391147 GAGGGTAGCTGGGTTGCCTCTGG - Intronic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1077369872 11:2176896-2176918 GTGGGGGTCTGGGAGGCTGCAGG - Intergenic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1077429643 11:2509766-2509788 GAGCGGGGCTGGGCGGCTGCTGG + Intronic
1077808464 11:5613150-5613172 CAGGGCAGCTGGGAAGGTGCAGG - Intronic
1078190935 11:9091864-9091886 GAGCGGAGCGGGGATGCGGGGGG - Intronic
1078434034 11:11309862-11309884 GAGGAGAGGTGGGATGGTCCTGG - Intronic
1078626360 11:12962404-12962426 AAGGAGAGCTGGGATGATGTGGG + Intergenic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1079518054 11:21290937-21290959 GAGAGGAGCTGTGATGCTTTGGG - Intronic
1080207974 11:29753125-29753147 GAAGCCAGCTGGGATGCTGCAGG + Intergenic
1080831081 11:35893963-35893985 TAGGGGAGCAGGGAGGCAGCTGG - Intergenic
1082828551 11:57598359-57598381 GACGGGAGGCGGGATGGTGCGGG + Intronic
1082983141 11:59142794-59142816 GGGAGGAGCTGGGACGCTGGCGG - Exonic
1083148533 11:60775801-60775823 GAGGGCAGCTGGGATGGGGCTGG - Exonic
1083332410 11:61905035-61905057 GAAGGGAGCTCTGCTGCTGCTGG - Intronic
1083548313 11:63565299-63565321 AAGGGGAACTGGGTTGCTGGAGG - Intergenic
1083812220 11:65112342-65112364 GAAGGGAACTGGGAGGCAGCGGG + Intronic
1083888028 11:65582158-65582180 GAGGGGGCCAGGGCTGCTGCAGG + Exonic
1083899846 11:65638298-65638320 GAGGGAAGTTGGGAGGGTGCTGG - Intronic
1083962254 11:66021014-66021036 GCGGGGAGCAGGGATGGGGCAGG - Intronic
1084052703 11:66610945-66610967 GGTGGGGGCGGGGATGCTGCTGG + Intergenic
1084295896 11:68213351-68213373 GCGGGGGGCTCGGACGCTGCGGG - Exonic
1084539390 11:69776517-69776539 GAGGGGACCTGGGAGGCTTGAGG + Intergenic
1084611910 11:70208690-70208712 GCAGGCAGCTGGGAGGCTGCGGG - Intergenic
1084892909 11:72245170-72245192 GAGGGGCCCAGGGATGATGCTGG + Intronic
1085375003 11:76052423-76052445 GAGGGGAGCTCAGCAGCTGCAGG - Intronic
1085386292 11:76160104-76160126 CAGGGGACCTGGGATGGTTCAGG + Intergenic
1086146389 11:83556835-83556857 AAGGCAAGCTGGGATGATGCGGG + Intronic
1086964031 11:93009257-93009279 GAGTGGAGGTGGGATGCAGTGGG + Intergenic
1086993557 11:93331134-93331156 GAGAGGAGCAGGGATGGTGAAGG - Intronic
1087442929 11:98208447-98208469 GAGGGAAGCTGGGGAGCTGAAGG - Intergenic
1089005103 11:115084412-115084434 GAGGGGCGGTGGAATGCAGCAGG - Intergenic
1089150108 11:116357802-116357824 GAGCGGAGCTGGGATGGGGCAGG + Intergenic
1089505469 11:118959083-118959105 GATGAGAGCTGGGATGTAGCTGG - Intergenic
1089614973 11:119690147-119690169 AAAGGGAGCTGTGATGCTGGAGG + Intronic
1089635420 11:119808646-119808668 GAGTGGAGTGAGGATGCTGCTGG + Intergenic
1089639399 11:119837715-119837737 GAGGGGGCCTGGGATGCCCCAGG + Intergenic
1089700175 11:120239996-120240018 GAGGGGGCCGGGGGTGCTGCCGG - Intronic
1089772175 11:120811112-120811134 TAGGTGAGCTGGCATGCAGCGGG + Intronic
1090717453 11:129442765-129442787 CAGGAGAGATGGGATCCTGCTGG - Intronic
1090796775 11:130142075-130142097 GTGAGGAGCTGGGCTGCTGAGGG + Intronic
1091642931 12:2251239-2251261 AAGGGAAGCTGAGTTGCTGCTGG + Intronic
1091750801 12:3020341-3020363 GAGGGCAGCTGGGGCCCTGCAGG - Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092219023 12:6700477-6700499 AAGGGGCGCTGGGAGGCTGGAGG + Intronic
1093607427 12:21109780-21109802 TAGTGGAGCTGGTAGGCTGCTGG - Intronic
1094025916 12:25959211-25959233 GAGGGCAGCTCCGAGGCTGCAGG - Intronic
1096415489 12:51408692-51408714 GAGGGGAACTGGGGCTCTGCTGG + Intronic
1096450815 12:51739614-51739636 AAGGGGAGCTCGGATGCCTCAGG - Intronic
1096487728 12:51994948-51994970 GAGGAGAGCTGTGCTGATGCTGG - Intronic
1096596567 12:52699639-52699661 GAGGAGACCTGGGGTGCTGAGGG - Intronic
1096636140 12:52960780-52960802 GAGGAGAGAGGGGAGGCTGCTGG - Intergenic
1097987463 12:65799045-65799067 GAGGAGAGCTGGGATGAGGGAGG + Intergenic
1100315091 12:93437828-93437850 CAGGGGAACTGGAATGCTGAAGG + Intronic
1101998860 12:109544296-109544318 GAGGGAAGTTGGGGTGCTGGTGG + Intergenic
1102259549 12:111435911-111435933 GACGGCAGCTGGCATGCAGCAGG + Intronic
1102278101 12:111598552-111598574 GGAGGGGGCGGGGATGCTGCGGG + Intronic
1102420681 12:112800613-112800635 GAGGGGAGCTGTGATGGGGCAGG + Intronic
1102643293 12:114385392-114385414 GGGAGGTGCTGGGTTGCTGCTGG + Intronic
1102812132 12:115833342-115833364 TTGGGAAGCTGGGATGATGCTGG - Intergenic
1103505560 12:121440648-121440670 GAGGGGATCTGGGAGGAGGCAGG - Intronic
1104567202 12:129895770-129895792 GAGGGCAGCTTAGATGCTGGTGG - Intronic
1104874939 12:132027122-132027144 GAGGTGTGCTGGGATGCTTCTGG + Intronic
1104932003 12:132344937-132344959 GAGGGGAGGTGGGAGGGAGCGGG - Intergenic
1104941909 12:132399243-132399265 GAGGGCAGCTGGGATGTGGAGGG - Intergenic
1105472339 13:20704528-20704550 GAGGGGCGCTGCGATGAGGCGGG + Intronic
1110317895 13:74132710-74132732 GAAGGGGGTTGGGAAGCTGCAGG + Intronic
1112029959 13:95447910-95447932 CAGGGCAGCTTTGATGCTGCAGG - Intronic
1113510824 13:110853698-110853720 GAGGGGAGCTGGGGACCTGGGGG - Intergenic
1113875476 13:113591989-113592011 AAGCGGAGTCGGGATGCTGCGGG - Intronic
1113961948 13:114131188-114131210 TAGGGGAGCTGGAATGCCTCCGG + Intronic
1115429163 14:33296546-33296568 GAGGGCACCTGGGGTGCAGCTGG + Intronic
1116716357 14:48431388-48431410 GAGGGGAGCTGGAAGGGGGCGGG + Intergenic
1117985154 14:61379730-61379752 GAAGGGGGCTGTGAGGCTGCAGG + Intronic
1118408191 14:65448234-65448256 GAAGAGTGCTGGGATGATGCAGG + Intronic
1119494736 14:75069249-75069271 GGCGGGAGCGGGGCTGCTGCTGG - Intronic
1119708978 14:76807576-76807598 GAGGCCAGGTGGGAAGCTGCTGG + Intronic
1119753603 14:77098390-77098412 GAGGGGAGCAGGGATGACGGCGG + Intronic
1119766952 14:77196240-77196262 GATGGGTGATGGGATGATGCCGG - Intronic
1119768374 14:77205125-77205147 GAGGGAAGGTGGCATGCTCCAGG + Intronic
1119857646 14:77912833-77912855 GAGTGGGACTGGGATGCTGTAGG - Intronic
1120212627 14:81648999-81649021 GAAGGGTAGTGGGATGCTGCGGG + Intergenic
1120525917 14:85576848-85576870 GAGGGGAGCAGAAATTCTGCTGG + Intronic
1121104087 14:91269585-91269607 CAGGGGAGCTGGGTTGATGAGGG + Intergenic
1121257071 14:92538960-92538982 GAGGGGGCCTGGGAGGCTGGGGG - Intronic
1122289821 14:100674563-100674585 CAGGGGAGCTGGGAGGCTGCTGG + Intergenic
1122761616 14:104032958-104032980 GAGGGGAGGTGGGATGAGGGTGG + Intronic
1122983715 14:105202805-105202827 GACAGGGACTGGGATGCTGCAGG + Intergenic
1202850000 14_GL000225v1_random:10162-10184 GGTGGCAGCTGGGAGGCTGCAGG - Intergenic
1202852887 14_GL000225v1_random:31835-31857 GGTGGCAGCTGGGAGGCTGCAGG - Intergenic
1202855052 14_GL000225v1_random:44577-44599 GGTGGCAGCTGGGAGGCTGCAGG - Intergenic
1202856521 14_GL000225v1_random:54601-54623 GGTGGTAGCTGGGATGCTGCAGG - Intergenic
1202857475 14_GL000225v1_random:59867-59889 GGTGGCAGCTGGGAGGCTGCAGG - Intergenic
1202859205 14_GL000225v1_random:71430-71452 GGTGGCAGCTGGGAGGCTGCAGG + Intergenic
1202861875 14_GL000225v1_random:88720-88742 GGTGGCAGCTGGGAGGCTGCTGG + Intergenic
1202863479 14_GL000225v1_random:100272-100294 GGTGGCAGCTGGGAGGCTGCAGG + Intergenic
1202922643 14_KI270724v1_random:1168-1190 GGTGGCAGCTGGGGTGCTGCAGG + Intergenic
1124641186 15:31397521-31397543 GAGGGGCGCTGGGAAGTTCCTGG + Intronic
1125680760 15:41528822-41528844 GAGGGAAGCTGGGAAACTTCTGG + Intronic
1125931068 15:43600511-43600533 GTGGGGAGCTGGGCCACTGCTGG - Intronic
1125944230 15:43700329-43700351 GTGGGGAGCTGGGCCACTGCTGG - Intergenic
1126183573 15:45809614-45809636 GAATGGGGCTGGGGTGCTGCAGG + Intergenic
1126189589 15:45865813-45865835 GAGGGGAACTGAGAGGCTTCTGG + Intergenic
1126363664 15:47871709-47871731 GAAGGGTGCTGAGATGCTGGTGG - Intergenic
1126662672 15:51048036-51048058 GAGTGGAGCAGGGAAGCTGGAGG + Intergenic
1126669579 15:51104081-51104103 CTGGGGAACTGGGAGGCTGCTGG - Intronic
1127336735 15:57993862-57993884 GATGGCAGCTGAGATGCTTCAGG - Intronic
1127647785 15:60975053-60975075 GAGGGGAGCTGAGAGGCTACTGG + Intronic
1127854194 15:62941397-62941419 TAGAGGAGCTGAGATGCAGCTGG - Intergenic
1127916404 15:63459075-63459097 GACCGGAACTGGGCTGCTGCAGG + Intergenic
1128080760 15:64855525-64855547 GAGGAAAGCTGGGGGGCTGCAGG - Intronic
1128232221 15:66043351-66043373 CAGGCCAGCTGGGATGCTGGGGG + Intronic
1128727571 15:69999258-69999280 GAGGCGAGGTGGGAGGCTCCTGG - Intergenic
1128742883 15:70095967-70095989 GCTGGGAGCCGGGCTGCTGCGGG + Intronic
1130753379 15:86737198-86737220 GAAGGGAGCTGGAAGGTTGCTGG + Intronic
1130844827 15:87734818-87734840 GAGGGGAGCGGGGAGGCGGGTGG - Intergenic
1130927147 15:88394189-88394211 GAGGGGAGGAGGGATGTTGGGGG + Intergenic
1130978428 15:88795009-88795031 GTGGGGAACTGGGAAGCAGCTGG - Intergenic
1131174632 15:90201904-90201926 GAGGGGAGCTGTGGGGCCGCTGG + Intronic
1131182446 15:90249776-90249798 GAGGAGAGCTGAGGGGCTGCTGG - Exonic
1131227628 15:90638553-90638575 CAGGGGCGCGGGGCTGCTGCAGG - Exonic
1131398495 15:92105747-92105769 CAGGGAAGCTGGGATGCAGAAGG + Intronic
1132312015 15:100864100-100864122 AGGGGGAGCTGGGATGCAGTGGG + Intergenic
1132554160 16:565338-565360 GAGAGGGGCCGGCATGCTGCAGG - Exonic
1132708031 16:1254877-1254899 AAGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132724843 16:1334128-1334150 GAGGGGTGCTGGGAGGCCCCGGG - Intronic
1133138531 16:3728806-3728828 GAGGGGAGCTGGGCGACTTCAGG + Exonic
1133233665 16:4377985-4378007 GAAGGGAGAGGGGATGCTGTGGG - Intronic
1133815195 16:9192022-9192044 GTGAGGAGCTGGGATGCAGAGGG + Intergenic
1134070100 16:11255545-11255567 GAGGTGAGCTGGGGCGCTGCGGG + Intronic
1134378918 16:13706306-13706328 GAGGAGGGCTTGGCTGCTGCAGG + Intergenic
1135158771 16:20075137-20075159 GAGGGGCGTTGGGAAGCAGCGGG - Intergenic
1135584083 16:23654456-23654478 GCGGGGAGTTGGGAGGGTGCAGG + Intronic
1136170481 16:28486438-28486460 TGGGGGAGCTGGGCTGCTGGGGG - Exonic
1137258260 16:46796432-46796454 GAGGGGAGCTAGGGAGATGCTGG + Intergenic
1137614829 16:49839838-49839860 GAGGGGAGCTGGGGGCCTGGAGG - Intronic
1138103646 16:54274823-54274845 GAATGGGGCTGGGATGCTGTGGG - Intergenic
1138183782 16:54961212-54961234 GAGGGGAGATGGGATGGGGAGGG + Intergenic
1138492200 16:57383139-57383161 GGGGGGAGGTGGGATCCTCCAGG + Exonic
1138591401 16:58001249-58001271 GCGGGGTGCCGGGAGGCTGCAGG + Intronic
1138609376 16:58110699-58110721 CTGGGGAGCTGGAAAGCTGCAGG + Intergenic
1139391093 16:66606407-66606429 GAGACGGGCTGGGAGGCTGCTGG - Intronic
1139470400 16:67175093-67175115 GATAGGACCTGGGATGCTGCTGG + Exonic
1139504675 16:67392969-67392991 CAGGGGAGCTTGGATGCCACAGG + Intronic
1139547205 16:67654931-67654953 GAGGGCAGATGGCATGCTGTGGG + Intronic
1139851656 16:69954138-69954160 GAGAGGAGCTGGGCTCCTCCTGG + Intronic
1139880632 16:70177045-70177067 GAGAGGAGCTGGGCTCCTCCTGG + Intronic
1139964471 16:70737887-70737909 GAGTGGAGCAGGGACCCTGCTGG - Intronic
1140252273 16:73304605-73304627 GAAGGGGGCAGGGATGCTGTGGG - Intergenic
1140371877 16:74418472-74418494 GAGAGGAGCTGGGCTCCTCCTGG - Intronic
1140954441 16:79849214-79849236 CTGGGGAGCTGGGCTGCTGCAGG - Intergenic
1141417351 16:83886218-83886240 GAGGGGACACGGGATGGTGCAGG + Intergenic
1141464973 16:84199297-84199319 GAGGGGAGCTGAGAGGCAGGAGG + Intergenic
1141894915 16:86953225-86953247 TAGGGGAGCTGCCAAGCTGCAGG - Intergenic
1141930004 16:87196043-87196065 GAGGGGTGCTGGGAAGTGGCCGG - Intronic
1142065335 16:88059199-88059221 GAGGAGAGTAGGGATGCTCCTGG + Intronic
1142209130 16:88799600-88799622 GTTGGGAGCTGGGAGGCTGAGGG - Intergenic
1142213330 16:88818888-88818910 GCTGGGAGCTGCGTTGCTGCTGG + Intronic
1142290413 16:89191648-89191670 GTGCGGGGCTGGGAGGCTGCAGG - Exonic
1142412273 16:89922914-89922936 ACAGGGAGCTGGGATGGTGCGGG + Intronic
1142560463 17:806257-806279 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142560481 17:806302-806324 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142596170 17:1031131-1031153 GTGGGGAGGGGAGATGCTGCCGG - Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1143173277 17:4942481-4942503 AAGGGGAGCTGGGCAGCTGAGGG + Intronic
1143411498 17:6712265-6712287 GAGGGGAGGTGGGGAGCTGGAGG + Intronic
1143433015 17:6900676-6900698 GAGGAAGGCTGGGATGCAGCTGG - Intronic
1144409943 17:14991165-14991187 AAGGGGATGTGGGATGCTGAAGG + Intergenic
1144647016 17:16981989-16982011 CAGGGGTGCGGGGATGCAGCAGG + Intergenic
1144872061 17:18377809-18377831 GAGGGCAGGTGGGAGGCAGCGGG - Exonic
1145029616 17:19494938-19494960 GAAGGGAGCTGGGAATCTCCCGG - Intergenic
1146446498 17:32936755-32936777 AAGGGGAGCTGGTATGTGGCTGG - Intronic
1146885269 17:36466077-36466099 GATGGGAGGTGAGACGCTGCTGG + Intergenic
1147042870 17:37731613-37731635 GAGAGGAGCTGGGCTGGTGGTGG + Exonic
1147142200 17:38466219-38466241 GGGTGGCTCTGGGATGCTGCGGG - Exonic
1147159973 17:38564017-38564039 GAGGCGAGCTGGCGTGCTGTAGG + Intronic
1147212798 17:38881812-38881834 GAGGGGAGCTAGGATCTTGCAGG + Intronic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1148072648 17:44917018-44917040 GAGGGGGGCTGGGGTGCGGCGGG + Intergenic
1148282239 17:46357567-46357589 GGTGGGAGCTGGGAATCTGCTGG - Intronic
1148304457 17:46575492-46575514 GGTGGGAGCTGGGAATCTGCTGG - Intronic
1148557012 17:48584862-48584884 GAGGGAGCCTGGGATGCTGGAGG - Intronic
1148680474 17:49470610-49470632 GTGGGGAGATGGGATGCAGCTGG + Intronic
1149376427 17:56048589-56048611 GAAGGCACCTGGGAAGCTGCAGG - Intergenic
1149518072 17:57295309-57295331 GAGGGGAGCTAGAAGGGTGCTGG + Intronic
1149607502 17:57935570-57935592 GAGGGCAGCGGGGATGGGGCGGG - Intronic
1149658392 17:58322272-58322294 GAGGGAAGCTGGCAGGCTGCTGG - Intronic
1150313171 17:64146159-64146181 GAGCGGAGCTGGGAGGGGGCTGG + Intergenic
1150433785 17:65139065-65139087 GAGGGGAGCTGGAATGGAGGAGG - Intronic
1150433847 17:65139246-65139268 ATGGGGAGCTGGGATGCAGGAGG - Intronic
1151338205 17:73452823-73452845 AAAGGGAGCTGGGATGGGGCTGG + Intronic
1151548046 17:74805467-74805489 CCGGGGAGCTGGCACGCTGCGGG - Intronic
1151749226 17:76027253-76027275 GAGGGCAGGTGGGAGGCAGCGGG + Exonic
1151792579 17:76318048-76318070 CATGGGAGCTGGGGTGCTGCTGG - Intronic
1152104945 17:78323342-78323364 GAGGGGAGCCTGGGTGCGGCAGG + Intergenic
1152162462 17:78677350-78677372 GAGGGGGGCTGGGCTGCGGTCGG + Intronic
1152215301 17:79028340-79028362 CTGGGGAGCAGGGAAGCTGCTGG + Intronic
1152250123 17:79208161-79208183 CAGCAGAGCTGAGATGCTGCTGG + Intronic
1152353656 17:79796840-79796862 AAGGGAAGCTGGGCTGCAGCAGG + Intronic
1152414503 17:80150526-80150548 GAGGGGCCCTGGGATGATGAGGG + Intergenic
1152638116 17:81438515-81438537 GTGGGGAGCAGGCATGCTGGAGG + Intronic
1152668136 17:81583680-81583702 GAGGGGAGCTGTGCAGATGCTGG - Intronic
1153943590 18:9997822-9997844 GATGGGAGCTGGCATGATGCTGG - Intergenic
1154251051 18:12745709-12745731 GAGGGGAGCTGGGAGAATACGGG - Intergenic
1154410782 18:14141088-14141110 GAGGGGAGAGAGGATTCTGCTGG + Intergenic
1154492937 18:14934979-14935001 GAGGGGGCCTGGGAGGGTGCAGG - Intergenic
1155461664 18:26090669-26090691 GCGGGGAGGGGGGATGCTCCGGG + Intronic
1155618999 18:27754240-27754262 GAGGGAAGCTGGTATGTTCCAGG - Intergenic
1156940032 18:42755967-42755989 GAGGGGAGGTGGGATGCTGGGGG + Intronic
1157491354 18:48125948-48125970 GAGGGGAGCTGGCATGCTGGCGG + Intronic
1157812230 18:50705503-50705525 GAGGTGAGCTGAGCTACTGCTGG + Intronic
1158904177 18:61995773-61995795 CAGGCCAGCTGGGAGGCTGCTGG + Intergenic
1159842513 18:73416019-73416041 GAGGGGAGCTGGAACACTTCGGG + Intergenic
1159892899 18:73969223-73969245 GATGAGAGCTGTGATTCTGCAGG - Intergenic
1160479741 18:79227681-79227703 GGGGGGAGGTGAGATGCTGAGGG - Intronic
1160541493 18:79626311-79626333 GAGGGGAACTCGGCTCCTGCAGG + Intergenic
1160722187 19:602624-602646 GAGGGGCACTGGGAAGCAGCAGG - Intronic
1160815252 19:1032473-1032495 GAGCGGAGCAGGGATGGTGCTGG + Intronic
1160941490 19:1622229-1622251 GAGGGGAGCTGGTAAGGTGGGGG + Intronic
1161058106 19:2200639-2200661 GAGGGGAGCAGGGAGGATGGCGG - Intronic
1161080087 19:2306280-2306302 GTGGGGAGCTGGGATTTTGTGGG - Intronic
1161470067 19:4452771-4452793 GATGGCAGCTGGGTTCCTGCTGG + Intronic
1161563262 19:4985510-4985532 GTGGAGACCTGTGATGCTGCTGG + Intronic
1162079213 19:8208885-8208907 GAGGGGACCTGGGAGGGGGCCGG + Intronic
1162621467 19:11847678-11847700 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162625250 19:11879948-11879970 GAGGAGAGCAGGGACTCTGCTGG + Intronic
1162630488 19:11923714-11923736 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1163738807 19:18998165-18998187 GAGGGCAGATGGGAGGCTGTAGG - Intronic
1164570272 19:29369475-29369497 GAGACCAGCTGAGATGCTGCTGG + Intergenic
1165119845 19:33552021-33552043 AAGGGGAACCTGGATGCTGCTGG + Intergenic
1165325851 19:35114435-35114457 GAGGGAAACTGGGAGGCTGGAGG - Intergenic
1165730581 19:38142359-38142381 GAGAGAAGCTGGGATGCTCCTGG - Intronic
1165891302 19:39113820-39113842 GAAGGGTGCTGGGAGGCTGCAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166887861 19:45972850-45972872 GAGGGAGGCTGGGAAGCTCCCGG + Intronic
1166936240 19:46334940-46334962 GTGGGGTGCTGGGGTCCTGCAGG - Exonic
1167271578 19:48509298-48509320 GAGGGGGGATGGGAGGCTGAGGG + Intronic
1167508161 19:49882026-49882048 GCGGGGAGCTGGGAGGCGGGAGG - Exonic
1168231463 19:55034975-55034997 GAGGTGGGCTGTGATGCGGCAGG - Intronic
1168276880 19:55283882-55283904 GAGAGGAGGTGGGAGGATGCAGG - Intronic
925058478 2:873251-873273 CAGGGCTGCTGAGATGCTGCAGG - Intergenic
925072942 2:985485-985507 AGGGGGAGCTGGGGAGCTGCAGG - Intronic
925174894 2:1775827-1775849 GAGGGGTGCTGGGTTCCTGTTGG - Intergenic
925684725 2:6459017-6459039 GAGGGGATGTGGGCTGCTTCTGG + Intergenic
925871812 2:8278239-8278261 GAGGGCAGCTGGGGTGCGGGAGG - Intergenic
925938143 2:8787903-8787925 GAGGGGAGCTGGGTTTCCCCAGG + Intronic
926045820 2:9708890-9708912 CTGGGAGGCTGGGATGCTGCTGG + Intergenic
927661926 2:25000744-25000766 GTGGGCATCTGGGAGGCTGCAGG + Intergenic
927809466 2:26173426-26173448 CCGGGGAGCTGGGAGGGTGCGGG - Intronic
927904986 2:26849225-26849247 GAGGGGAGGAGGGATGCAGGCGG + Intronic
928438565 2:31272482-31272504 GAGGGGACCTAGGCTGCAGCAGG + Intergenic
929055138 2:37870034-37870056 GATGGCAGCAGGGATGATGCAGG + Intergenic
929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG + Intronic
930089272 2:47520161-47520183 GAGGGGAGCGGTGAGGCTGCAGG - Exonic
930571140 2:53088570-53088592 GGGGGTGGCTGGGATGCTGATGG - Intergenic
931784312 2:65605530-65605552 CAGGGGAGCCGGAATGCTACTGG + Intergenic
932261232 2:70329375-70329397 CAGGTGAGCTGGGAAGCAGCAGG + Intergenic
932605458 2:73162886-73162908 GAAGGGAAATGGGAGGCTGCTGG + Intergenic
932605576 2:73163297-73163319 GAGGGGAGGTGGGGTGTGGCGGG - Intergenic
933157487 2:78992130-78992152 GAGGGAAGCTGGTCTGCAGCAGG - Intergenic
933610984 2:84435068-84435090 GAGGGAAGCTGGGACTCTGCTGG - Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933940210 2:87238939-87238961 GGAGGGAGCTGGGAAACTGCGGG + Intergenic
934675404 2:96246352-96246374 GTGAGGAGCTGGGAGGGTGCTGG + Intergenic
934778095 2:96951477-96951499 GCGGGGAGCTGGGAGGCAGAGGG + Exonic
935726790 2:106030606-106030628 CAGGGGTGCTGGGGAGCTGCGGG + Intergenic
936017519 2:108971020-108971042 GAGGGGACAGGGGATGATGCTGG + Intronic
936152561 2:110029798-110029820 GAGGTGGGCTGGGAGGCCGCAGG + Intergenic
936192119 2:110341614-110341636 GAGGTGGGCTGGGAGGCCGCAGG - Intergenic
936352928 2:111726837-111726859 GGAGGGAGCTGGGAAACTGCGGG - Intergenic
936521804 2:113216252-113216274 GAAGGGATCTGAGATGCGGCTGG - Exonic
937134910 2:119544365-119544387 CGGGGGAGCCGGGCTGCTGCGGG - Intergenic
937208670 2:120253137-120253159 GAGCGGAGCGGGGCCGCTGCCGG - Intronic
937227368 2:120377514-120377536 GAGAGGCGCTGGTATGCAGCTGG - Intergenic
937273952 2:120672437-120672459 GAGGGGTGGTGGGGTGCTGGGGG - Intergenic
937301214 2:120843596-120843618 CAGGGCAGCTGGGACTCTGCAGG + Intronic
937337549 2:121071233-121071255 GAGGGGAGCGGAGGTGGTGCTGG - Intergenic
937350036 2:121154879-121154901 TAGGGGAGCTTGGAGGCTGTTGG + Intergenic
937984005 2:127630478-127630500 AAGGGGAGCTGGGGAGCTGGGGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940347003 2:152638425-152638447 GAGGGGAGGAGGGATGTGGCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941489642 2:166127298-166127320 GAAGGCAGCGGGGCTGCTGCTGG - Intronic
942424293 2:175842790-175842812 AAGAGGAGATGGGATCCTGCAGG - Intergenic
943390955 2:187267296-187267318 GAGAGGAGCTGGCCTGCTCCAGG + Intergenic
945599689 2:211845149-211845171 GTCGGGAGCTGGCATGCTGCAGG - Intronic
946175190 2:217918293-217918315 CGGGGGAGCTGGGATGCAGAAGG + Intronic
946212704 2:218160295-218160317 GATTGGAGCTGGAAGGCTGCTGG + Intergenic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947758202 2:232584441-232584463 GAGGGAAGCTTCCATGCTGCAGG - Intergenic
947800272 2:232925266-232925288 GAAGGCAGCTGGGCTGCTGCAGG + Intronic
947865759 2:233397139-233397161 GAGGGGACCAGGGTGGCTGCGGG + Intronic
947865867 2:233397467-233397489 GAGGGGAGCAGGGTGGCTGGCGG + Intronic
948055905 2:235009203-235009225 GAGGGGAGCTGGGCAGCAGGAGG - Intronic
948273361 2:236690560-236690582 GAAGAGAGCTGGGGTGGTGCAGG + Intergenic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948507150 2:238435939-238435961 CAGGGGTGCTGCGATGGTGCCGG - Exonic
948565252 2:238882215-238882237 CAGGAGACCTGGGCTGCTGCTGG - Intronic
948918557 2:241050935-241050957 CACGGAAGCTGGGATGCTGGGGG - Intronic
1168893151 20:1307319-1307341 GCTGGGAGCAGGGAGGCTGCAGG - Exonic
1170498778 20:16953120-16953142 AAAGGAAGCTTGGATGCTGCTGG - Intergenic
1171209308 20:23304699-23304721 TCGGGGAGGTGGGATGCTGTTGG - Intergenic
1171209314 20:23304718-23304740 TTGGGGAGGTGGGATGCTGTCGG - Intergenic
1171209379 20:23304936-23304958 GAAGGGAGATGGGATGCTGCCGG - Intergenic
1171304802 20:24096092-24096114 GAGGGGCAATGGGATGCAGCCGG + Intergenic
1171970695 20:31563204-31563226 GAGAAGGGCTGGGCTGCTGCTGG - Intronic
1172106034 20:32517788-32517810 GAGGGCACCTGGGACGCAGCGGG - Intronic
1172670585 20:36632292-36632314 GAGTGGACCTGGGATCCTGAGGG - Intronic
1173362257 20:42355224-42355246 CAGGGAAATTGGGATGCTGCAGG - Intronic
1173662571 20:44744781-44744803 GAGGGGATCCGGGATGCACCGGG - Intergenic
1173665508 20:44760162-44760184 GAACAGAGCTGAGATGCTGCAGG + Intronic
1174303078 20:49596090-49596112 GGGGAGAGCTGAGATGCTGAGGG + Intergenic
1174870093 20:54173936-54173958 GAGGGTAGATGAGATGCTGCTGG + Exonic
1175199284 20:57266709-57266731 GAGGGCAGGTGGGAGGCCGCCGG - Intergenic
1175259303 20:57664576-57664598 GAGGAGCGCAGGGAGGCTGCTGG + Intronic
1175458635 20:59134187-59134209 GAGGGGAGCAGGGGATCTGCTGG - Intergenic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1176169877 20:63691962-63691984 CAGGGCAGCTGTGATGCTGACGG + Intronic
1176263215 20:64194242-64194264 GAGAGGAGCTGGGAAGAGGCAGG + Intronic
1176862279 21:14017330-14017352 GAGGGGAGAGAGGATTCTGCCGG - Intergenic
1177596898 21:23256291-23256313 GAGGGGGGCTTGGATGCATCAGG + Intergenic
1178470590 21:32889117-32889139 AAGAGGAGCTGGGATGCTCAGGG - Intergenic
1179486271 21:41712583-41712605 AAAGGGAGGTGGGGTGCTGCCGG - Intergenic
1179519300 21:41931880-41931902 GTGGGGTGGTGGGATGCTGGAGG - Intronic
1179519308 21:41931902-41931924 GTGGGGTGGTGGGATGCTGGAGG - Intronic
1179519316 21:41931924-41931946 GTGGGGTGGTGGGATGCTGGAGG - Intronic
1179519324 21:41931946-41931968 GTGGGGTGGTGGGATGCTGGAGG - Intronic
1179519332 21:41931968-41931990 GTGGGGAGGTGGGATGCTGGAGG - Intronic
1179519340 21:41931990-41932012 GTGGGGAGGTGGGATGCTGGAGG - Intronic
1179519348 21:41932012-41932034 GTGGGGTGGTGGGATGCTGGAGG - Intronic
1179836309 21:44036117-44036139 GAAGGGAGTTGGGATACTGCAGG + Intronic
1179874720 21:44262039-44262061 GTGGGGAGCTAGGAAGCTGGGGG + Exonic
1180037796 21:45258711-45258733 GAGGTGAGCTGGGCGGCCGCGGG + Intergenic
1180041627 21:45283231-45283253 GGGGGGAGGCGGGGTGCTGCAGG + Intronic
1180162687 21:46005416-46005438 AAGGGGAGTTGAGATACTGCAGG + Intergenic
1181002701 22:19995307-19995329 GTGGGCAGATGGGATGCTGAAGG + Intronic
1181041939 22:20196430-20196452 CAGGGGAGCTGGGATTTTCCAGG + Intergenic
1181306812 22:21921676-21921698 GGAGGCAGCAGGGATGCTGCTGG - Exonic
1181487688 22:23241829-23241851 GAGGGGAGCCTAGAGGCTGCAGG - Intronic
1182254804 22:29030744-29030766 GAGGGGAGGAGGGACCCTGCAGG + Intronic
1182664404 22:31946449-31946471 GAGTGGTGCTGGGATTATGCAGG + Intronic
1182756279 22:32682179-32682201 GAGTGGGGGTGGGATGCTACTGG + Intronic
1182942066 22:34286403-34286425 CAGCAGGGCTGGGATGCTGCGGG - Intergenic
1183000869 22:34857594-34857616 GAGGGGAGGTGGGGTGCTAGGGG - Intergenic
1183102941 22:35594923-35594945 CAGGGCAGATGGGATGCCGCTGG - Intergenic
1183279133 22:36922833-36922855 GAGAGGAGGTGGGAGGTTGCAGG + Intronic
1183321361 22:37167042-37167064 GAGGGGACCTCGGAGGCTGGAGG - Intronic
1183327603 22:37202926-37202948 GAGGGGAGCTGGGAACCCGCAGG - Intergenic
1183524081 22:38313702-38313724 GAAGGGACTTGGGTTGCTGCTGG - Intronic
1184129989 22:42512016-42512038 GCAGGGAGCTGGAATGCTGTGGG + Exonic
1184140167 22:42573834-42573856 GCAGGGAGCTGGAATGCTGTGGG + Intronic
1184369710 22:44074709-44074731 GTGGGCAGCTGGGAAGCTGAGGG - Intronic
1184398432 22:44259502-44259524 CAGGGGAGCTGGGAAACAGCAGG + Intronic
1184412415 22:44332666-44332688 GACTGGAGCTGGGGGGCTGCCGG - Intergenic
1184751384 22:46488373-46488395 TAGGCGAGCAGGGAAGCTGCGGG - Intronic
1184903867 22:47465483-47465505 CAGGGGAGGTGGGGTGCTGAGGG - Intronic
1185095413 22:48803636-48803658 GAGGGCAGCTGGGAAGATGGTGG + Intronic
1185175604 22:49324856-49324878 CTGGGGAGTTGGGATGGTGCTGG - Intergenic
1185319114 22:50192386-50192408 GTGGGGAGCTGTGATGCCTCGGG + Intronic
949675439 3:6447920-6447942 GAGGGGAGCTGGGAAGGGGACGG + Intergenic
950105448 3:10385573-10385595 GTGGTTAGCTGGGATGGTGCTGG + Intronic
951453192 3:22862600-22862622 GGGGTGAGCTGGCAAGCTGCAGG + Intergenic
952932266 3:38369480-38369502 GAGGTGGGCTGGGATGCTGATGG - Intronic
953609091 3:44432763-44432785 GAGGGAAGCTGGGATGTTGGAGG - Intergenic
953661533 3:44894628-44894650 GAGGGGAGGTGGGAAGCATCTGG - Intronic
954292647 3:49657908-49657930 GAGGGGACTTGGGAGGCTGGCGG - Exonic
954411801 3:50374215-50374237 GAGGGGAGGGGGGATGGTGAGGG + Intronic
954578420 3:51689792-51689814 GAGTGGAGCTGGGAGGCACCAGG + Intronic
955148888 3:56347400-56347422 GAGGAAAGCTGGGAGGCTGGAGG + Intronic
958548459 3:95587950-95587972 AAGGGGACCCGGGTTGCTGCTGG + Intergenic
959180693 3:102976013-102976035 CAGGAGTGCTGGGATGGTGCAGG - Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960582610 3:119294050-119294072 GAGGTGCGCTGGCATTCTGCGGG - Intergenic
961008333 3:123419808-123419830 GAGGGGAGCTGAGCAGCAGCTGG - Intronic
961422506 3:126817539-126817561 GTGGGGAGCGGGGGTTCTGCAGG - Intronic
961476940 3:127152914-127152936 GAGTGGAGTGGAGATGCTGCAGG + Intergenic
961529088 3:127528928-127528950 CAGGGCAGCTGGGATGGGGCTGG - Intergenic
961554594 3:127689366-127689388 GAGGGAAGCTGGGTCGCTGCTGG + Exonic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
964307541 3:155357146-155357168 GAGGGGAGCTGGAAAGAAGCAGG + Intergenic
966742351 3:183245436-183245458 GATGGGGGCTGGGAGGCTGGGGG + Intronic
967016669 3:185488611-185488633 GAGCAGACCTGGGATGCTGCCGG - Exonic
968075609 3:195814530-195814552 GAGGGGAGCTGGAAAGCAGAAGG - Intergenic
968619373 4:1596990-1597012 TAGGGGAGATGCGATGCTGGAGG - Intergenic
968691339 4:1991950-1991972 GCTGGGAGGTGGGAGGCTGCTGG - Intronic
968805871 4:2772084-2772106 GGAGGGAGCAGGGTTGCTGCTGG + Intergenic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
969367896 4:6710002-6710024 GAGGGGCGCCGGGAAGCAGCTGG - Intergenic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
969619686 4:8272845-8272867 GAGTGCAGGTGGGAGGCTGCTGG + Intronic
969624914 4:8297520-8297542 GAGGGGTGCTGGGAGGAGGCTGG + Intronic
969861030 4:10035404-10035426 GAGAGGAGCTGGGATGCCTGTGG - Intronic
970569136 4:17362546-17362568 GAAGGGAGCTGGGTTATTGCAGG - Intergenic
970938897 4:21607932-21607954 CTGGGGAGCTGAGACGCTGCAGG + Intronic
971469216 4:27001838-27001860 GAAGGGAGTTGGGATGATGGTGG + Intronic
971741609 4:30528485-30528507 GAGGAGAGCAGGCACGCTGCTGG - Intergenic
972020330 4:34305376-34305398 AATGGGAGCTGGCATTCTGCAGG + Intergenic
973735291 4:53865388-53865410 GAGAGGAACTGGGAAGGTGCAGG - Intronic
975352051 4:73357774-73357796 GAGGGGAGCTCGGAAGCATCAGG + Intergenic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
976264109 4:83173947-83173969 GAAGGGATCTGGGAGGCTGCAGG - Intergenic
976370196 4:84279181-84279203 GTTGGGAGCTGGGATGAGGCAGG - Intergenic
976699693 4:87956335-87956357 GAAGGGAGGTGGGTTGCTGTGGG - Intergenic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
979580981 4:122360165-122360187 GAGGGGCACTGTGATGCTGCAGG - Intronic
979950446 4:126886291-126886313 GTGGGGGTCTGTGATGCTGCTGG - Intergenic
980102246 4:128553300-128553322 GAAGGGAGCCGGGATGAAGCAGG - Intergenic
980347061 4:131635176-131635198 GTTGGGAGCTGGGAGGCTGGTGG - Intergenic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
981898645 4:149835453-149835475 GAGGGGTGCTGGGAGGGTGACGG - Intergenic
981906957 4:149932236-149932258 GAGGGGAGATTGGGTGCTGAGGG - Intergenic
983339306 4:166437565-166437587 AAGGTGAACTGGGATTCTGCGGG - Intergenic
985463796 4:190175565-190175587 GCTGGCAGCTGGGAGGCTGCAGG - Intronic
985606600 5:861411-861433 GAGCGGATCTTGGATTCTGCAGG + Intronic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
985685181 5:1278091-1278113 GAGGAGAGTAGGGATGCTGGTGG - Intronic
985689132 5:1297433-1297455 AGGGGCAGCTGGGAGGCTGCAGG - Intergenic
985695217 5:1336241-1336263 GCAGGCAGCTGGGATGCAGCAGG - Intronic
985828203 5:2208192-2208214 TAGCAGACCTGGGATGCTGCCGG - Intergenic
986060833 5:4188585-4188607 GAGGAGAACTGGGATACTCCAGG + Intergenic
986299243 5:6465618-6465640 GGGGGGCTCTGGGATGCTTCGGG + Intronic
986695933 5:10354118-10354140 GAGGGGGGCGGGGACCCTGCCGG + Intronic
986731460 5:10637718-10637740 GTGGGGGGCAGGGACGCTGCGGG - Intronic
986795107 5:11202638-11202660 GATGGGAGAGGGGAGGCTGCAGG - Intronic
986848774 5:11785882-11785904 GAGGGGAACTGCCCTGCTGCAGG + Intronic
991009701 5:61870268-61870290 GAGAGGAGGAGGGAGGCTGCTGG - Intergenic
991674086 5:69075112-69075134 GGGTGTAGCTGGGATGCGGCGGG - Intergenic
992098978 5:73388267-73388289 TGGGGGTGCTGGGAAGCTGCTGG - Intergenic
993901083 5:93584683-93584705 GAGGGGAGCAGGGGTGTTGGGGG + Exonic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
997528962 5:134570602-134570624 GAGGTGGGCAGGGAGGCTGCAGG - Intronic
997601517 5:135141761-135141783 GAGGGCACCTGGGATGCTGAGGG + Intronic
997821587 5:137070809-137070831 GACAGGAGAGGGGATGCTGCAGG - Intronic
998252133 5:140560583-140560605 GGGGTGAGCAGGGATGCTGAGGG - Intronic
998349034 5:141489023-141489045 GAGTGGAGCTGGGGAGCTGGAGG - Intronic
998817927 5:146032352-146032374 GAGGGGAAGTGGCATGCTGAAGG - Intronic
999047927 5:148489726-148489748 CAGGGGAGCTGGGCTGCAGCGGG + Intronic
999277648 5:150342302-150342324 GAGGGGAACTGTGAGACTGCAGG - Intergenic
999763580 5:154721533-154721555 GAAAGGAGCTGGGAAGCAGCTGG + Intronic
1001544006 5:172558778-172558800 AGGGGGAGCTCGGAGGCTGCTGG + Intergenic
1001706531 5:173744881-173744903 CAAGGGAGCTTGGATCCTGCTGG - Intergenic
1001796487 5:174506473-174506495 GAGGGAAGCTGGGGTGCAGAGGG + Intergenic
1001966106 5:175911029-175911051 GAGGGGAGAGGAGATGCAGCTGG + Intergenic
1001966692 5:175914586-175914608 GAGGGGAGCTGGCAAGAAGCGGG + Intergenic
1002088522 5:176791058-176791080 GAGGAGAACTGGGATGCAGGGGG - Intergenic
1002250256 5:177924618-177924640 GAGGGGAGCTGGCAAGAAGCAGG - Intergenic
1002250839 5:177928173-177928195 GAGGGGAGAGGAGATGCAGCTGG - Intergenic
1005402359 6:25447965-25447987 GTGGGCAGCTGGCTTGCTGCAGG - Intronic
1005582620 6:27248966-27248988 GAAAGGAGTTGGGATGCTGGTGG + Intronic
1005676377 6:28159824-28159846 GTGGGCAGCTGGGATGCTATTGG + Intergenic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006914906 6:37587914-37587936 GAGGGAAGCGGGGCTGCGGCTGG - Intergenic
1007398878 6:41592382-41592404 GAGAGAAGCTGGGAGGCTGTTGG + Intronic
1007626986 6:43252267-43252289 GAGAGGAGGTGGGGTGCTGATGG + Intronic
1007727163 6:43923589-43923611 GAGAGGAGCTTGGAGCCTGCTGG - Intergenic
1009524671 6:64728891-64728913 GAGGGGAGCTGGAAAGCAGATGG + Intronic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1010733421 6:79414670-79414692 GATGGGAGCTGGAAAGCTGTGGG + Intergenic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1013524135 6:110958893-110958915 GAAGGGAGTTGGGGAGCTGCGGG + Intronic
1014863942 6:126505471-126505493 GAGGGGAGCTTGGAAGCATCAGG + Intergenic
1016924032 6:149323565-149323587 GATGGGAGGTGGGATGCTGGTGG - Intronic
1016997539 6:149970849-149970871 CAGGGGAGCTGAGCTGCTGCTGG + Intronic
1017282964 6:152643185-152643207 AAGGGCAGCTGTGATGCTGTTGG - Intergenic
1017904889 6:158751241-158751263 GAGGGGGCTTGGGCTGCTGCTGG + Intronic
1018246953 6:161832832-161832854 GGCAGGAGCGGGGATGCTGCTGG - Intronic
1018560687 6:165098465-165098487 GAAGGGAGGTGGGATCCTGAAGG - Intergenic
1018861912 6:167717158-167717180 CAGTGGAGCGGGGCTGCTGCTGG - Intergenic
1019343353 7:518641-518663 AAGGGGAGCTGGGGCGCAGCGGG - Intronic
1019352777 7:562730-562752 GAGGGAAGATGAAATGCTGCTGG - Intronic
1019989870 7:4683292-4683314 GATGGGAGCTGGGGAGCAGCAGG - Intronic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1022532112 7:31073646-31073668 GAGAGGAGGTGGGAGCCTGCTGG + Intronic
1022952871 7:35355367-35355389 GTAGGGAGCTGGGATGCGGCAGG - Intergenic
1023089776 7:36607109-36607131 GAGAGGAGAGGGGCTGCTGCAGG + Intronic
1023232533 7:38050015-38050037 GTGGGGGGCGGGGATCCTGCAGG - Intergenic
1023861827 7:44221308-44221330 GAGTGGGGCCGGGAAGCTGCAGG - Intronic
1024151495 7:46576336-46576358 GAGGGGCCCTGGGAGACTGCAGG + Intergenic
1024629939 7:51238698-51238720 GGTGGGGGCTGGGAGGCTGCTGG - Intronic
1024948273 7:54833547-54833569 GAGAGGAGCTGAGATCCGGCCGG + Intergenic
1026438008 7:70416817-70416839 GAGGGGAGCAGGGGTGCAGGAGG - Intronic
1026843465 7:73683807-73683829 GAGGGGAGCCTGAATACTGCGGG + Intronic
1026964570 7:74431042-74431064 GAGGAGTGCTGGGCTGCTGAGGG - Intergenic
1028186079 7:87786219-87786241 AAGTGGAGCTGGGCTGCTACTGG - Intronic
1028475284 7:91246909-91246931 GTGGGGAGCTTGGCTGGTGCTGG + Intergenic
1029129914 7:98322121-98322143 GTGGGGAACTGAGAGGCTGCAGG + Intronic
1029485201 7:100836097-100836119 AGTGGGTGCTGGGATGCTGCTGG - Intronic
1029531493 7:101128313-101128335 GAGGGGAGCTGGCCAGCTGTGGG - Intronic
1029552445 7:101244687-101244709 GACGGGATCTGGGATCATGCAGG - Intronic
1029587902 7:101487071-101487093 CAGGGAAGCTGGGAAGATGCAGG + Intronic
1029736654 7:102469116-102469138 GAGGGGAGCGTGGAGGCTACTGG - Intronic
1029982375 7:104890908-104890930 CTGGGGAGCTGGGGCGCTGCTGG - Intronic
1030377891 7:108774710-108774732 TAGGGGAATTGGGAGGCTGCAGG - Intergenic
1033049137 7:137988279-137988301 GAGGGGAGCAGGGATGTGTCTGG + Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033606003 7:142928982-142929004 GAGGGGAGCTGGGATGCTGTGGG - Intronic
1033797588 7:144865875-144865897 GAAGGCAGCTGGGATTCTGATGG + Intergenic
1034426432 7:151016605-151016627 GTGGGGAGCTGGGGCGCTGAGGG - Intronic
1035035127 7:155889844-155889866 GACTGGAGCTGGGGTGCTGGGGG - Intergenic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1035332499 7:158105476-158105498 GAGTGGAGATGGGATGGAGCTGG - Intronic
1035827630 8:2661382-2661404 GAGGTGAGCTGGGGTGATTCTGG + Intergenic
1036613223 8:10367810-10367832 GAGGGTAACTGGGATGAGGCAGG + Intronic
1036784505 8:11677102-11677124 GTGGGAGGCTGGGATGCTGGGGG + Intronic
1037252493 8:16912936-16912958 GTGGGGCTCTGGGCTGCTGCTGG + Intergenic
1038498751 8:28025896-28025918 GAGGGGAACTGGAAGGCTGGAGG - Intronic
1039252756 8:35684663-35684685 GAGAGGAGCTGGGTTGGTGCAGG - Exonic
1039930567 8:41984334-41984356 GAGGCCAGCTGCCATGCTGCAGG + Intronic
1040718025 8:50282137-50282159 GAGGGGAGCTGGTATGTCTCTGG - Intronic
1041795113 8:61738763-61738785 GAAGGTAGCTGAGATGCAGCTGG + Intergenic
1043072276 8:75653485-75653507 AAGGGGAGCTGGGCTTCTGATGG + Intergenic
1047928441 8:129703136-129703158 GAGGAGAGCTGGGATCCAGAAGG - Intergenic
1048139283 8:131777451-131777473 GGGGACAGCTGGGATGCTGGAGG - Intergenic
1048513698 8:135085886-135085908 GATGGCAGCTGGGATGCTGGAGG + Intergenic
1049184315 8:141241410-141241432 GAAGGGAGATGGGAGGCTGCGGG + Intronic
1049233620 8:141496907-141496929 GAGGGGAGTGGGGGAGCTGCAGG + Intergenic
1049347205 8:142145407-142145429 GCGGGGAGCTGCGGTCCTGCAGG + Intergenic
1049453507 8:142675335-142675357 GAGGGGAGCTGGTTTGGGGCAGG + Intronic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1049583241 8:143422040-143422062 GACGGGAGCAAGGGTGCTGCAGG + Intronic
1049587870 8:143440337-143440359 GTGGGGCGCTGGGATGCTGAAGG + Exonic
1050602325 9:7265436-7265458 GAAGGGAGATGGGAGGCTTCAGG + Intergenic
1051100353 9:13513995-13514017 GAGGGCAGATGGGACGCTCCTGG - Intergenic
1051587540 9:18742552-18742574 GATGTGAGCTGGGATGGTGAGGG + Intronic
1052498790 9:29261843-29261865 GGGGTGAGTTGGGATGGTGCTGG - Intergenic
1053014520 9:34654395-34654417 GAGAGGAACTGGGAGCCTGCAGG - Intronic
1053061573 9:35036177-35036199 AACTGGAGCTGGGTTGCTGCCGG + Intergenic
1053379076 9:37634593-37634615 GAAGGGAACTGGGAAGCGGCAGG - Intronic
1053482054 9:38423429-38423451 GGGCTGAGCTGGGATGCTGAGGG - Intronic
1054824691 9:69561434-69561456 GAAGGTAGCTTGGATGCTGGGGG + Intronic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1055550185 9:77425937-77425959 GAGAAGAGCTGGGATGCTACAGG - Intronic
1056453591 9:86739595-86739617 GAGGGGATGTGTGATGGTGCAGG - Intergenic
1057041051 9:91847607-91847629 GAGGAGAGCTGGGGTGCAGTTGG - Intronic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057225432 9:93290547-93290569 GGTGGGTGCTGGGATGTTGCAGG + Intronic
1057301816 9:93890780-93890802 GGGGGGACCTGGGAAGCTGTGGG + Intergenic
1059421641 9:114196106-114196128 CAGGGGAGCTGGGCTGGGGCTGG - Intronic
1059441350 9:114308824-114308846 GAGGTGCGATGGGGTGCTGCCGG - Intronic
1060046961 9:120349089-120349111 GAGGGGAGAGGGGCTGCTGGAGG - Intergenic
1060729390 9:126027633-126027655 CAGGGGAAGTGGGATGCTGTGGG - Intergenic
1061685629 9:132275115-132275137 CGAGGAAGCTGGGATGCTGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061807369 9:133144022-133144044 CAGGGGAGCTGGGATGCCTGAGG - Intronic
1061807429 9:133144276-133144298 TAGGGGACCTGCGAGGCTGCAGG - Intronic
1061956221 9:133962514-133962536 CAGGGCACCTGGGCTGCTGCGGG + Intronic
1062010289 9:134263479-134263501 GAGGGCAGCTGGGGTGGTACAGG - Intergenic
1062046399 9:134426472-134426494 CAGGGGAGCTGAGATGCAGCCGG + Intronic
1062267272 9:135692940-135692962 GAGGGGAGCTGGGTTACTTCGGG - Intergenic
1062722179 9:138050264-138050286 GCGGGGAGCTGGGCTGGAGCTGG + Intronic
1203687212 Un_GL000214v1:6441-6463 AAGGGGAGCTCGGAAGCTTCAGG + Intergenic
1203736862 Un_GL000216v2:144993-145015 GGTGGTAGCTGGGAGGCTGCAGG - Intergenic
1203740851 Un_GL000216v2:175740-175762 GGTGGCAGCTGGGAGGCTGCAGG - Intergenic
1203649063 Un_KI270751v1:97612-97634 AAGGGGAGCTCGGAAGCTTCAGG - Intergenic
1186410602 X:9342282-9342304 GAGGGGAGGTGGGAAGGAGCAGG - Intergenic
1187480291 X:19648869-19648891 GAGGGAAGCTGGAAGGCTGACGG - Intronic
1189349649 X:40267050-40267072 TTGGGGAGCTGAGCTGCTGCAGG + Intergenic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1194670490 X:96726527-96726549 GAGGTGAGGTGGGATGGAGCGGG + Intronic
1197929264 X:131678410-131678432 GAGGGGAGCAGGCAGGCTACCGG - Intergenic
1199829784 X:151538156-151538178 GAGGGGAGCTGGGGAGCTGCCGG + Intergenic
1200136723 X:153878864-153878886 GTGGGGAGATGGGATGGGGCTGG - Intronic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1200216327 X:154369638-154369660 GAGGGGAGCTGGGAGGAGGGAGG + Intronic
1200308570 X:155053997-155054019 GAGGGGAGGTGGGAAGCTTTGGG + Intronic
1201176064 Y:11308686-11308708 GGTGGCAGCTGGGATGCTGCAGG - Intergenic
1201178430 Y:11323336-11323358 GGTGGGAGCTGGGAGGCTCCAGG - Intergenic
1201180039 Y:11334108-11334130 GGGGGCAGCTGGGAGGCTGCAGG - Intergenic