ID: 1033600138

View in Genome Browser
Species Human (GRCh38)
Location 7:142883481-142883503
Sequence GGGCCTGCCCCATTCATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033600132_1033600138 0 Left 1033600132 7:142883458-142883480 CCATTTACTTGCTCTAGGGTTCT 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 149
1033600128_1033600138 24 Left 1033600128 7:142883434-142883456 CCCTTTGGAACAAATTCAACTTC 0: 1
1: 0
2: 0
3: 21
4: 250
Right 1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 149
1033600129_1033600138 23 Left 1033600129 7:142883435-142883457 CCTTTGGAACAAATTCAACTTCA 0: 1
1: 0
2: 1
3: 22
4: 235
Right 1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 149
1033600127_1033600138 25 Left 1033600127 7:142883433-142883455 CCCCTTTGGAACAAATTCAACTT 0: 1
1: 0
2: 0
3: 17
4: 242
Right 1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033600138 Original CRISPR GGGCCTGCCCCATTCATAGG GGG Intronic
901311456 1:8272289-8272311 GGTCCTGCCCCATTCCTTTGGGG - Intergenic
901733144 1:11294966-11294988 TGGCCAGCCCCATTCTCAGGAGG - Intronic
902704941 1:18198289-18198311 GGACCTGCCCAAGTCATAAGTGG + Intronic
903514800 1:23903062-23903084 GGGGCAGCACCATTCATGGGCGG + Intronic
903642962 1:24872224-24872246 TGTTCTGCCTCATTCATAGGGGG + Intergenic
904809014 1:33151301-33151323 GGGCCTGCCACTCTCTTAGGCGG + Intronic
904823126 1:33257814-33257836 GGGCCTGTCTCCTTCATGGGTGG + Intronic
906059161 1:42937026-42937048 AGGCCTGTCCCATGCATTGGAGG - Intronic
910030543 1:82716393-82716415 GGTCCTGCCCCATACACAAGAGG + Intergenic
912520246 1:110240211-110240233 AGGCCTGCCCCAGCCTTAGGTGG + Intronic
914876820 1:151518510-151518532 GTGCCTGCTCCATAAATAGGAGG - Exonic
918047370 1:180949524-180949546 GGGCCTGCCCCACTGACGGGGGG + Exonic
920216872 1:204367257-204367279 GGGCCTGACCAACTCCTAGGAGG + Intronic
920400792 1:205675173-205675195 GGTCCTACCCCATTCCTGGGAGG - Intronic
922785489 1:228280475-228280497 GCGCCTGTCCCATTCCTAGTGGG - Intronic
922814651 1:228439901-228439923 GGTCCTGCCCCATACCCAGGAGG + Intergenic
923887086 1:238169902-238169924 GGGCCTGCTTCTTTCATAAGTGG + Intergenic
1062835828 10:635231-635253 GAGCCCACCCCATTCACAGGTGG - Intronic
1064979159 10:21148973-21148995 GGTCCTGCCCCATACCCAGGAGG + Intronic
1071293700 10:84204410-84204432 AGGCCTGACCCTTTCCTAGGTGG + Intronic
1072464141 10:95647647-95647669 GGTCCTGCCCCATACCTTGGAGG + Intronic
1074301345 10:112235691-112235713 GGGCCTGTCCCATGCAAAGAGGG - Intergenic
1076426937 10:130373645-130373667 GGGCCTGCCCCATCCCTGTGGGG + Intergenic
1077113514 11:872541-872563 GGGCCTGGCCCAGCCACAGGAGG - Intronic
1077320273 11:1937926-1937948 AGGCCGGCCCCATTCAGACGCGG - Intronic
1080112593 11:28585174-28585196 GGGCATGCCTCATGCAGAGGAGG - Intergenic
1080499289 11:32853304-32853326 GTGCCTCCCCCTTTCATAGACGG - Exonic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084956035 11:72692199-72692221 GGGGCTGCCCTGTTCCTAGGGGG - Intronic
1086650216 11:89279368-89279390 GGCCCTGCCCTATACGTAGGAGG + Intronic
1090240090 11:125175659-125175681 TGGCCTGCCTCACTCATAGCTGG - Intronic
1090479542 11:127055949-127055971 GGGCCTGGCCCATCCATCAGAGG + Intergenic
1090925976 11:131250877-131250899 GGGCTTGACCCATTAGTAGGAGG - Intergenic
1091938759 12:4455092-4455114 GGTCCTGCTCCATTCCTAGGAGG + Intergenic
1100647245 12:96544612-96544634 GGTCCTGCCCCATACCCAGGAGG + Intronic
1100704567 12:97186295-97186317 GGCCCTGCCCTATGCATGGGAGG - Intergenic
1100963928 12:99991933-99991955 GGTCCTGCCCCATACCCAGGAGG - Intergenic
1104043274 12:125144366-125144388 GGGCCTGCTGCAATCACAGGGGG - Intergenic
1105480668 13:20772980-20773002 AGGCCTTACCCATTCATAGAGGG - Intronic
1107042063 13:35959450-35959472 TGAGCTGCCCCATTTATAGGTGG - Intronic
1107377101 13:39815839-39815861 GGGCCTGCCCTGTGCATTGGAGG + Intergenic
1107477715 13:40755652-40755674 GATCCTGCCCCAGTCATAGCAGG + Intronic
1110707084 13:78608582-78608604 GGCCCTGCCGCATTCAAAGCTGG + Intergenic
1112410153 13:99155797-99155819 GGGCCTGCCTCAAACACAGGGGG - Intergenic
1118316222 14:64727764-64727786 GAGCCTGCCCCATTCTTGGCGGG - Exonic
1125001536 15:34775737-34775759 GGGCATGCCCCCTTCACAGGTGG - Intergenic
1125900926 15:43346419-43346441 GGGGCTGCCCCATGCATTGTAGG + Intronic
1131175359 15:90205920-90205942 GGTCCAGCCCCATGCAGAGGAGG - Intronic
1132343072 15:101090202-101090224 GGGCCTCCCCCATGCCTTGGTGG + Intergenic
1133117692 16:3587536-3587558 GAGCCTGCCGCTTTCATCGGGGG - Intronic
1134292656 16:12914974-12914996 GGGCCTGCTGAATTCATGGGTGG + Intronic
1137807029 16:51316897-51316919 GGGCTTATGCCATTCATAGGTGG + Intergenic
1141063712 16:80897636-80897658 GGGCCTGCCCCATTTCGAGTGGG - Intergenic
1141836540 16:86543920-86543942 TGGCATGCACCATTCATACGAGG - Intronic
1141929553 16:87192849-87192871 GGGCCGGCCCCATCAATGGGCGG - Intronic
1151543656 17:74778565-74778587 GGGCCTGTGCCATTCATGTGTGG + Intronic
1151714428 17:75824074-75824096 GGCCATGCCCCATGCAGAGGTGG + Intronic
1153689298 18:7575343-7575365 GGTCCAGCCCCATCCATAGATGG + Intronic
1157470825 18:47986783-47986805 CTGCCAGCCCCATCCATAGGGGG - Intergenic
1160717870 19:584574-584596 GGGCCTGCCCCACTCAGCGTGGG - Intergenic
1161452001 19:4351433-4351455 GAGCCAGCACCATACATAGGTGG - Intronic
1167981804 19:53282170-53282192 AGACCTGCCCCATTAAGAGGTGG + Intergenic
1167984288 19:53301492-53301514 AGACCTGCCCCATTAAGAGGTGG - Intergenic
1168289409 19:55350233-55350255 GGGCCTGTCCCATGCATTGCAGG + Exonic
928129215 2:28637552-28637574 TGGCCTGCCTCCTTCAGAGGTGG - Intronic
931027874 2:58134278-58134300 GGTCCTGCCCCATCCCCAGGAGG + Intronic
931243655 2:60475368-60475390 GGGCCACCCACATTCATTGGGGG - Intronic
934173424 2:89558692-89558714 GGTCCTGCCCCATACCCAGGAGG + Intergenic
934283739 2:91633045-91633067 GGTCCTGCCCCATACCCAGGAGG + Intergenic
935803990 2:106728732-106728754 GGGCCTGCTCCATCCATGTGAGG + Intergenic
935953835 2:108354884-108354906 GTGCCAGCCCCATTTATAGCAGG - Intergenic
936403474 2:112183327-112183349 GGTGCTGCCCCTTTCAGAGGTGG - Intronic
936731377 2:115385215-115385237 GGTCCTGCCCCATACCTGGGAGG + Intronic
943298376 2:186166359-186166381 GTGCCTGCCCAAATCATAGTTGG + Intergenic
944852234 2:203731849-203731871 AGGACTGCCCAATTCACAGGGGG - Intronic
945293740 2:208150135-208150157 GGGCCTGCACCATTGCTTGGTGG + Intergenic
946089311 2:217206830-217206852 CCACGTGCCCCATTCATAGGTGG + Intergenic
947186761 2:227462588-227462610 GGGACTTCCCCACTCATAAGCGG + Intergenic
1169293631 20:4374101-4374123 GGTCCTGCCCCATCCCCAGGAGG + Intergenic
1169841080 20:9938393-9938415 GGGGCTGTCCCATTCATTGCAGG - Intergenic
1172352228 20:34252105-34252127 GGGCAGGCCCCCTTCATAAGAGG - Intronic
1173564321 20:44028260-44028282 GGGGCTGCCCCATTCCCAGAGGG + Intronic
1177181958 21:17753859-17753881 GGTCCTGCCCCATACCCAGGAGG + Intergenic
1178056332 21:28803039-28803061 GTGCCTGACCCATTCTTAGAAGG - Intergenic
1185157221 22:49201252-49201274 GTGCCTGCCCCTTTCATGGGTGG + Intergenic
950472495 3:13194710-13194732 AGGCCTGCCAGATTCAAAGGAGG - Intergenic
950931383 3:16792306-16792328 GGTCCTGCCCCATACCTGGGAGG + Intergenic
953010880 3:39024350-39024372 GGTCCTGCCCCATACCCAGGAGG - Intergenic
953025357 3:39141930-39141952 GGGCCTGCCCCTTGCCCAGGAGG - Exonic
954563668 3:51580151-51580173 GGGAATGCCCTATTCATAGCTGG - Intronic
955372808 3:58368175-58368197 GGTCCTGCCCCATACCCAGGAGG - Intronic
955801160 3:62688158-62688180 GGGCCTGTCCTATTCATTGTAGG + Intronic
960946034 3:122967421-122967443 GTGCCTGCCCCATTTGTGGGTGG + Intronic
961473686 3:127134215-127134237 CTGCCTGCCCCATTCAGTGGGGG - Intergenic
962385613 3:134930031-134930053 GGGTTTGCCCCATCCAGAGGAGG + Intronic
963643128 3:147882138-147882160 AGGCCTTCCCAATTCATGGGTGG - Intergenic
963729518 3:148957833-148957855 GGGAGTCCCCCATCCATAGGGGG + Intergenic
963778136 3:149460831-149460853 TGGCCTGCCCACTTCATTGGCGG + Intergenic
963920145 3:150897530-150897552 GGGCCTGCTCCATGCACAGCTGG - Intronic
964842404 3:161008255-161008277 GGCCCTGCCCCATACCCAGGAGG + Intronic
969827283 4:9767505-9767527 GGTCCTGCCCCATACCTGGGAGG + Intergenic
976266519 4:83190546-83190568 GGTCCTGCCCCATCCCCAGGAGG - Intergenic
977396100 4:96472702-96472724 GGTCCTGCCCCATACCTGGGAGG - Intergenic
979713789 4:123812310-123812332 GGGTCTCCTCCATTCATAGAGGG - Intergenic
981429427 4:144643360-144643382 GGGCATGACCTATGCATAGGTGG + Intergenic
985250720 4:188022044-188022066 GGCCCTGCCCCATACCCAGGAGG - Intergenic
985746738 5:1652316-1652338 GGGCAGGGCCCATTCTTAGGAGG + Intergenic
988245371 5:28674001-28674023 GGGCCTACCCTAGTCATAGATGG - Intergenic
988289167 5:29262809-29262831 GGGATTGCCCCATACCTAGGTGG - Intergenic
988492978 5:31720750-31720772 GGTCCTGCCCCATCCCCAGGAGG - Intronic
989480920 5:41929224-41929246 GGGCCTGCCCTATGCATTGTAGG + Intronic
989539666 5:42604401-42604423 GGTCCTGCCCCATTCCCTGGAGG - Intronic
990604586 5:57395955-57395977 GGTCCTGCCCCATTCCCAGGAGG - Intergenic
993109080 5:83633118-83633140 GGTCCTGCCCCATACCCAGGAGG + Intergenic
998010830 5:138694411-138694433 GGACCTGCCCCATACCTTGGAGG - Intronic
999256313 5:150211651-150211673 GGGCCTGGCCCTTTGTTAGGGGG - Intronic
999808980 5:155110173-155110195 GGTCCTGCCCCATACCTAGAAGG - Intergenic
1000241011 5:159408047-159408069 GGGTCTGCCCCATTCCCAGAAGG + Intergenic
1001002821 5:168023521-168023543 GGGCCTGCCTCAGTCATGGCCGG + Intronic
1007345938 6:41229446-41229468 GGGTCTACCCCATACATAAGAGG - Intronic
1009242765 6:61200834-61200856 TGGCTTGCCCCATTCGTAGCAGG + Intergenic
1011935334 6:92770006-92770028 GGGCCTGCTCGATTCATGGCAGG - Intergenic
1015439210 6:133228413-133228435 GGGGCTGCCCAATTAGTAGGAGG - Intergenic
1018560531 6:165097585-165097607 AGGCCTTCGCCCTTCATAGGTGG + Intergenic
1019072820 6:169363559-169363581 AAGCCTGCCCAATTCATAAGAGG + Intergenic
1019554420 7:1621683-1621705 GTGGCTGCCCCACTCATAGGTGG + Intergenic
1019915522 7:4129833-4129855 GGGCCTGCCCCATGCCACGGCGG + Intronic
1020798194 7:12701218-12701240 GGTCCTGCCCCATTCCCTGGAGG - Intergenic
1022787537 7:33653337-33653359 GGTCCTGCCCCATCCCCAGGGGG - Intergenic
1032379270 7:131459214-131459236 GGTCCTGCCCCATTCCCAGGAGG - Intronic
1033600138 7:142883481-142883503 GGGCCTGCCCCATTCATAGGGGG + Intronic
1034050684 7:147981052-147981074 TGCCCTGCCCAATTCACAGGAGG - Intronic
1035692644 8:1570298-1570320 GTGCCAGCCACAGTCATAGGGGG - Intronic
1037114826 8:15211686-15211708 GAACCAGTCCCATTCATAGGCGG - Intronic
1037766657 8:21776296-21776318 GGGGCTGCCCCATTTCTTGGGGG - Intronic
1038387585 8:27163844-27163866 GGGGCTGCCCCATGCATTGTAGG + Intergenic
1043463379 8:80482810-80482832 GGGGATGCCCCATTCTTAAGGGG + Intergenic
1045341021 8:101254571-101254593 GGCCCTGCCCCATACCTAGTAGG + Intergenic
1045524913 8:102933363-102933385 GGGACTGCCCCATTTATCAGAGG + Intronic
1049436938 8:142590776-142590798 GGTCCGGCCCCATTCTTTGGAGG + Intergenic
1049966557 9:785292-785314 GGTCCTGCCCCATACCCAGGAGG - Intergenic
1053491223 9:38505113-38505135 GGGCCTGCACCATGCTTAGGAGG + Intergenic
1053538852 9:38952636-38952658 AGCCCTGCCCCATTCCCAGGGGG - Intergenic
1054627288 9:67411283-67411305 AGCCCTGCCCCATTCCCAGGGGG + Intergenic
1056729839 9:89156048-89156070 GGGTCAGCCCCATTCAATGGGGG - Intronic
1057671531 9:97094314-97094336 GGGCCTGCACCATGCTTAGGAGG + Intergenic
1057788825 9:98109166-98109188 GGGCCTGCCCCACTGAGAGCTGG - Intronic
1059511006 9:114846859-114846881 ATGCCAGCCCCATTAATAGGTGG + Intergenic
1062320041 9:135986373-135986395 TGGCCTGCCCCACTCCCAGGTGG + Intergenic
1187694433 X:21904523-21904545 GGCCCTATCCAATTCATAGGAGG + Intergenic
1189264033 X:39699971-39699993 GGTCCTGCCCCATGCTCAGGAGG - Intergenic
1189861136 X:45273660-45273682 GATCCTGCCCCATACCTAGGAGG - Intergenic
1190343589 X:49317248-49317270 GGGCCTGCCAAATCCAGAGGAGG + Exonic
1190365459 X:49689436-49689458 GGGCCTGCCAAATCCAGAGGAGG - Exonic
1194904557 X:99558438-99558460 GGGTGTGCACCATTCATTGGTGG + Intergenic
1195342092 X:103916272-103916294 GGTCCTGCCCCATACCCAGGAGG - Intergenic
1195350915 X:103996328-103996350 GGTCCTGCCCCATACCCAGGAGG + Intergenic
1199852628 X:151736508-151736530 GGGCAGGCCCCTTTCAGAGGTGG + Intergenic