ID: 1033601062

View in Genome Browser
Species Human (GRCh38)
Location 7:142888742-142888764
Sequence ATGTCAGGAGGTGCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033601062_1033601075 26 Left 1033601062 7:142888742-142888764 CCCAGGGCAGCACCTCCTGACAT No data
Right 1033601075 7:142888791-142888813 GTCAAGGAGTGGGCATGCCCAGG No data
1033601062_1033601070 10 Left 1033601062 7:142888742-142888764 CCCAGGGCAGCACCTCCTGACAT No data
Right 1033601070 7:142888775-142888797 GGTTCTGTAACCCACAGTCAAGG No data
1033601062_1033601071 15 Left 1033601062 7:142888742-142888764 CCCAGGGCAGCACCTCCTGACAT No data
Right 1033601071 7:142888780-142888802 TGTAACCCACAGTCAAGGAGTGG No data
1033601062_1033601076 29 Left 1033601062 7:142888742-142888764 CCCAGGGCAGCACCTCCTGACAT No data
Right 1033601076 7:142888794-142888816 AAGGAGTGGGCATGCCCAGGAGG No data
1033601062_1033601072 16 Left 1033601062 7:142888742-142888764 CCCAGGGCAGCACCTCCTGACAT No data
Right 1033601072 7:142888781-142888803 GTAACCCACAGTCAAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033601062 Original CRISPR ATGTCAGGAGGTGCTGCCCT GGG (reversed) Intergenic