ID: 1033602925

View in Genome Browser
Species Human (GRCh38)
Location 7:142901691-142901713
Sequence CGGCTTGGACGCCTATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033602925_1033602928 -4 Left 1033602925 7:142901691-142901713 CCAATCAATAGGCGTCCAAGCCG No data
Right 1033602928 7:142901710-142901732 GCCGTTCATGCCTGGAGCTCCGG No data
1033602925_1033602934 28 Left 1033602925 7:142901691-142901713 CCAATCAATAGGCGTCCAAGCCG No data
Right 1033602934 7:142901742-142901764 TAAGGTGACGATAAGGAGCTAGG No data
1033602925_1033602931 10 Left 1033602925 7:142901691-142901713 CCAATCAATAGGCGTCCAAGCCG No data
Right 1033602931 7:142901724-142901746 GAGCTCCGGAGACAGATCTAAGG No data
1033602925_1033602933 21 Left 1033602925 7:142901691-142901713 CCAATCAATAGGCGTCCAAGCCG No data
Right 1033602933 7:142901735-142901757 ACAGATCTAAGGTGACGATAAGG No data
1033602925_1033602935 29 Left 1033602925 7:142901691-142901713 CCAATCAATAGGCGTCCAAGCCG No data
Right 1033602935 7:142901743-142901765 AAGGTGACGATAAGGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033602925 Original CRISPR CGGCTTGGACGCCTATTGAT TGG (reversed) Intergenic
No off target data available for this crispr