ID: 1033604214

View in Genome Browser
Species Human (GRCh38)
Location 7:142913894-142913916
Sequence AGGGAGGGGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4052
Summary {0: 1, 1: 2, 2: 38, 3: 460, 4: 3551}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033604214_1033604224 22 Left 1033604214 7:142913894-142913916 CCTTCCTCTTTCTGCCCCTCCCT 0: 1
1: 2
2: 38
3: 460
4: 3551
Right 1033604224 7:142913939-142913961 ACCCACCCTCTCCTTCCCTCTGG 0: 1
1: 0
2: 7
3: 54
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033604214 Original CRISPR AGGGAGGGGCAGAAAGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr