ID: 1033606412

View in Genome Browser
Species Human (GRCh38)
Location 7:142931306-142931328
Sequence CTAAATAACCTGAGGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033606412_1033606424 11 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606424 7:142931340-142931362 TGCAGGGGGTGGAGAGTTGTGGG No data
1033606412_1033606423 10 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606423 7:142931339-142931361 CTGCAGGGGGTGGAGAGTTGTGG 0: 1
1: 0
2: 8
3: 72
4: 542
1033606412_1033606418 -4 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606418 7:142931325-142931347 TTAGATACAGGTCCCTGCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 159
1033606412_1033606416 -6 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606416 7:142931323-142931345 ATTTAGATACAGGTCCCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 99
1033606412_1033606419 -3 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606419 7:142931326-142931348 TAGATACAGGTCCCTGCAGGGGG No data
1033606412_1033606427 24 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606427 7:142931353-142931375 GAGTTGTGGGGTGAGTTACAGGG 0: 1
1: 0
2: 0
3: 8
4: 149
1033606412_1033606425 12 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606425 7:142931341-142931363 GCAGGGGGTGGAGAGTTGTGGGG 0: 1
1: 0
2: 5
3: 54
4: 541
1033606412_1033606426 23 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606426 7:142931352-142931374 AGAGTTGTGGGGTGAGTTACAGG 0: 1
1: 0
2: 0
3: 13
4: 146
1033606412_1033606420 0 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606420 7:142931329-142931351 ATACAGGTCCCTGCAGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 177
1033606412_1033606417 -5 Left 1033606412 7:142931306-142931328 CCCAGCATCCTCAGGTTATTTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1033606417 7:142931324-142931346 TTTAGATACAGGTCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033606412 Original CRISPR CTAAATAACCTGAGGATGCT GGG (reversed) Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906222043 1:44088408-44088430 CTAAATAGCCTAAGCAGGCTGGG - Intergenic
907458420 1:54590904-54590926 ATAAATAAGCTGAGCATGGTAGG - Intronic
907711000 1:56881401-56881423 CTAAATAGCTAGTGGATGCTGGG - Intronic
908750641 1:67419401-67419423 TTGAACAACATGAGGATGCTAGG - Intronic
917428291 1:174938398-174938420 CTAATTAAACTGAGGATGGATGG - Intronic
919393273 1:197014154-197014176 CCAAATATCCTGAGGCTCCTGGG - Intergenic
920692808 1:208159702-208159724 CTAAATAACCTCAGGAGGGCCGG + Intronic
1068703839 10:60050561-60050583 CCAAATAACTTGAGGCTTCTTGG - Intronic
1072010493 10:91299038-91299060 CTAGATTAGCAGAGGATGCTGGG - Intergenic
1073478362 10:103769278-103769300 CTAAATAACCTGGGTATATTGGG - Intronic
1074104484 10:110378133-110378155 CTAAATAACCAGAGGACGTGTGG + Intergenic
1074345852 10:112685697-112685719 CAAAATAACATGAGGTTGATGGG - Intronic
1078956125 11:16197127-16197149 CTAAAAAGCCAGAGGATGTTGGG - Intronic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1084897332 11:72282963-72282985 GTAAATACCCAGAGGATTCTGGG - Intergenic
1086161747 11:83729445-83729467 TTGATTAACCTGAGGAAGCTTGG - Intronic
1088844231 11:113651530-113651552 CTTAATAACCAGAGGAGCCTAGG + Intergenic
1088953057 11:114589780-114589802 ATTAATAACCTGAAGATGCAGGG + Intronic
1089840085 11:121409023-121409045 CAAAATAACTTGAGGTTCCTGGG + Intergenic
1089940950 11:122417010-122417032 CTAAATATCCCGAGGTTCCTGGG - Intergenic
1090619222 11:128546814-128546836 CTATATGACATAAGGATGCTGGG + Intronic
1095459339 12:42425680-42425702 TTTAAAAACCTGAGGAGGCTGGG - Intronic
1097102280 12:56598241-56598263 TTAAATAACCCCAGAATGCTGGG + Exonic
1100787176 12:98090561-98090583 CTAAAAAATCTGAGGGTCCTTGG + Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1104683937 12:130772126-130772148 CCAAGTCAGCTGAGGATGCTGGG - Intergenic
1106865110 13:33955756-33955778 CCAAATAACTTCATGATGCTGGG + Intronic
1107131140 13:36896846-36896868 CTTAATAACATGAAAATGCTTGG - Intronic
1107561711 13:41562693-41562715 CTACAGAGCCTGAGGCTGCTGGG - Intergenic
1107616745 13:42176696-42176718 CTGAATAAACTGAGGCTGATTGG + Intronic
1108231928 13:48353907-48353929 CTAAAAAACCTGAGGATAGAAGG + Intronic
1108777920 13:53788614-53788636 TTTAAGAACCTGAGGATGATTGG - Intergenic
1111649845 13:91075646-91075668 TTCCATAACCTGAGTATGCTTGG + Intergenic
1112407693 13:99135665-99135687 TTCAACAACCTGAGGAAGCTTGG + Intergenic
1115259022 14:31434170-31434192 ATAAATAACTGGAGAATGCTGGG + Intronic
1117522882 14:56568380-56568402 CTAAATACCTTGATGATGTTGGG + Intronic
1202842791 14_GL000009v2_random:138497-138519 CCAAATAACTTGAGGTTCCTGGG + Intergenic
1202912189 14_GL000194v1_random:128739-128761 CCAAATAACTTGAGGTTCCTGGG + Intergenic
1128182767 15:65619432-65619454 CTAAGTAACTGGAGCATGCTGGG - Intronic
1133643025 16:7736063-7736085 CTAAATAACCTTAGGAGGGTAGG - Intergenic
1136348700 16:29693558-29693580 ATAAATAAAATGAGGATGATGGG - Intronic
1137378198 16:47973061-47973083 CTGAATACCTAGAGGATGCTGGG - Intergenic
1138649078 16:58447756-58447778 CAAAATTACCTGGGGATGATGGG - Intergenic
1139586392 16:67906799-67906821 CTAAATACCCTGGGGCTGGTGGG - Intronic
1142529382 17:568714-568736 GTAAATATACTGAGCATGCTAGG + Intronic
1143814906 17:9505012-9505034 CTAAATATCCTGAGGAGTGTGGG - Intronic
1143942720 17:10559411-10559433 CAGAATAACCTGCAGATGCTTGG + Intergenic
1154158546 18:11962476-11962498 ATAAATATCCTGAGACTGCTGGG - Intergenic
1157356160 18:46936442-46936464 CTACATAACCTGGGGGTGCTGGG + Intronic
1157945416 18:51974090-51974112 CTAAATAACTTAAGTATGTTGGG + Intergenic
1158447640 18:57534949-57534971 CTAGATAACATGCTGATGCTGGG + Intergenic
1159024679 18:63172350-63172372 CTAAACACCCTGATGCTGCTTGG + Intronic
1159894085 18:73980307-73980329 ATCACTAACCAGAGGATGCTAGG - Intergenic
1168489871 19:56799805-56799827 ATAAATAACCAAAGTATGCTAGG + Intronic
925274131 2:2636933-2636955 CTATAACACCTGAGGCTGCTGGG - Intergenic
926860037 2:17300088-17300110 ATAATGAAGCTGAGGATGCTGGG - Intergenic
931437232 2:62258440-62258462 CCAAATAACTTGAGGTTCCTGGG + Intergenic
933920679 2:87041937-87041959 ATTAATAACCTAAGGATGCAGGG + Intergenic
933930946 2:87151849-87151871 ATTAATAACCTAAGGATGCAGGG - Intergenic
934002319 2:87727961-87727983 ATTAATAACCTAAGGATGCAGGG - Intergenic
935850096 2:107209333-107209355 CAAAATAACCTGAAGTTCCTGGG + Intergenic
936362177 2:111813594-111813616 ATTAATAACCTAAGGATGCAGGG + Intronic
937810274 2:126191903-126191925 TTAAATAACCTGAGGTACCTGGG - Intergenic
939034768 2:137117664-137117686 CTAAATCACCAGTGGATGATGGG - Intronic
940950538 2:159667663-159667685 CTAAATTACCTTAGCATCCTTGG + Intergenic
941220756 2:162777219-162777241 ATAAAGAACTTGAGTATGCTTGG - Intronic
941597645 2:167497617-167497639 CTAAAGAACCTGAGGGAGATTGG + Intergenic
943023930 2:182606471-182606493 ATAAATACCTTGAGGAGGCTGGG - Intergenic
943178360 2:184508243-184508265 GTATAAAACCTGAGGATACTAGG - Intergenic
943280843 2:185930467-185930489 TTACATAACCTGAGAACGCTTGG - Intergenic
943619140 2:190128289-190128311 CTAAAGAACCTAAAAATGCTTGG + Intronic
947123044 2:226836937-226836959 CTAAATAATCCCAGGACGCTAGG + Intronic
1169051248 20:2579790-2579812 ATAAATAACCTGAGGCTCTTTGG - Intronic
1169733001 20:8806773-8806795 CTACTTACCCTCAGGATGCTAGG + Intronic
1171193236 20:23176560-23176582 CTAAAAAAACTGAGGGTCCTGGG - Intergenic
1171856088 20:30344787-30344809 CTAAAAAAACCGAGGATGGTGGG - Intergenic
1173208640 20:41014551-41014573 CTAAATAAACTGAGAAAGCCGGG + Intergenic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1174884993 20:54323770-54323792 CCCAATCACCTGAAGATGCTAGG + Intergenic
1175123081 20:56731405-56731427 CTAAATTACCCTAGGATGATAGG - Intergenic
1176631546 21:9143416-9143438 CCAAATAACTTGAGGTTCCTGGG + Intergenic
1177180821 21:17743303-17743325 CAAAATAACTTGAGGTTCCTGGG + Intergenic
1182221490 22:28762256-28762278 GTAAATAAGATGAGGACGCTGGG - Intergenic
1182676948 22:32046670-32046692 CTTAAGAAACTGAGGATGTTGGG - Intronic
1185183308 22:49376716-49376738 TTAAATAACCTGAGGTTTATGGG - Intergenic
950172359 3:10847801-10847823 CCAAAAAACCTTTGGATGCTGGG - Intronic
951836368 3:26987744-26987766 CAAAATAACCTAAGAATGCATGG + Intergenic
951993383 3:28700764-28700786 CCAAATTCCCTGAGGAAGCTGGG + Intergenic
952866537 3:37859268-37859290 CTCAGGAACCTGAGGATGGTGGG + Intergenic
954281632 3:49583815-49583837 CTAAATTACCTAAGGATGTGTGG + Intronic
956858870 3:73302848-73302870 CTAACTAGCCTGGGGATGCCAGG + Intergenic
959455778 3:106559487-106559509 CTAAATACTATGAGGATTCTTGG + Intergenic
959962593 3:112315939-112315961 CAAAATAACTTGAGGTTCCTGGG + Intergenic
961740529 3:129030762-129030784 GTAATGAACCTGAAGATGCTGGG + Exonic
971583923 4:28380646-28380668 TTAAAGAACCTAAGGAGGCTGGG + Intronic
975209000 4:71677295-71677317 AAAAATAACCACAGGATGCTGGG - Intergenic
975484642 4:74921875-74921897 CTTAATAAGTTGAGGATGTTGGG + Intergenic
977697767 4:99985874-99985896 CTAAAAAAGTTGAGGAGGCTGGG + Intergenic
977970630 4:103209812-103209834 TAAAATAACCAGAGGCTGCTTGG - Intergenic
978312513 4:107400324-107400346 ATAAATAACCTGAGCATTCTAGG - Intergenic
979266445 4:118708713-118708735 AGAAATAACCTAAGGATGATGGG + Intronic
980612478 4:135177511-135177533 CCAAATAACTTGAGGTTTCTGGG - Intergenic
980721135 4:136697066-136697088 ATAAATAATCTGATGAGGCTGGG + Intergenic
983262456 4:165471698-165471720 CTAAATAACCTGGGGCTCCTAGG + Intronic
986218895 5:5748868-5748890 CTAAATAATCTCTGCATGCTTGG - Intergenic
987489333 5:18556518-18556540 CAAAATATCCTGAGGTTCCTAGG - Intergenic
987578704 5:19761001-19761023 CCAATAAACCTGGGGATGCTGGG - Intronic
989639812 5:43572477-43572499 CAAAATATCCTGAGGCTCCTGGG + Intergenic
990692679 5:58381306-58381328 CAAGATAACCTGAGGCTCCTAGG - Intergenic
993678126 5:90842373-90842395 ATAAATAACCTGGGAATACTTGG + Intronic
1001062946 5:168509624-168509646 GAAAAAAACCTCAGGATGCTAGG - Intronic
1001273659 5:170334418-170334440 ACAGATAAACTGAGGATGCTAGG - Intergenic
1002845244 6:939558-939580 CTAAATGGCCTTAGGATGCAGGG + Intergenic
1004113382 6:12743536-12743558 CTAGATAACCTGGGGCTGCTGGG + Intronic
1007024008 6:38551220-38551242 CTGAATAACCTGAGTATTGTAGG - Intronic
1007225856 6:40313644-40313666 CTAAATAACCCTAATATGCTGGG + Intergenic
1009637730 6:66286669-66286691 CAAAATAAACTGTGGATCCTTGG - Intergenic
1010573949 6:77509911-77509933 ATTAATAACCTGAAGATGCAGGG - Intergenic
1011864248 6:91802614-91802636 ATAAATCACTGGAGGATGCTTGG - Intergenic
1011892322 6:92180370-92180392 CTCAATTGCCTGAGGTTGCTTGG + Intergenic
1014961350 6:127689281-127689303 CAAAATATCCTGAGGTTCCTGGG + Intergenic
1019390742 7:785385-785407 GCAAATAACCTGACGCTGCTGGG - Intronic
1020736852 7:11960933-11960955 CAAAATAACTTGAGGTTCCTAGG + Intergenic
1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG + Intergenic
1026469516 7:70682953-70682975 TTAAATAACCAGAAGCTGCTGGG + Intronic
1027582700 7:80019249-80019271 CTAAACAACCTCAGAACGCTTGG + Intergenic
1032639827 7:133753736-133753758 CTAAATACACTCAGCATGCTAGG - Intronic
1032921555 7:136554522-136554544 ATATACAATCTGAGGATGCTGGG - Intergenic
1033001950 7:137515074-137515096 TTAAATATACTAAGGATGCTTGG + Intronic
1033606412 7:142931306-142931328 CTAAATAACCTGAGGATGCTGGG - Intronic
1036744798 8:11399080-11399102 CTAAAAAACCTGAGGCTGGCCGG - Intronic
1040350319 8:46560310-46560332 CTAAGTAACATCAAGATGCTTGG - Intergenic
1041151322 8:54937788-54937810 CTATATCACCTGAGTTTGCTTGG - Intergenic
1041805470 8:61844406-61844428 CAAAATAACTTGAGGATCCTGGG - Intergenic
1041939386 8:63370001-63370023 GTAAGTGACCTGAGGTTGCTGGG - Intergenic
1044230144 8:89765345-89765367 CTGAATATCCTGATGTTGCTTGG + Exonic
1046540040 8:115568044-115568066 CCAAATAACATTATGATGCTGGG - Intronic
1047303248 8:123633229-123633251 CTAAATAAACCTTGGATGCTTGG - Intergenic
1050063727 9:1737318-1737340 ATAAATATCCTGAGGATTGTTGG - Intergenic
1050844683 9:10200009-10200031 GTAAAAAACCTTAGTATGCTAGG - Intronic
1051117838 9:13717400-13717422 CTAAATACCCTCAGGTTTCTTGG + Intergenic
1051136642 9:13930219-13930241 CTGAATAATCTGATGTTGCTTGG - Intergenic
1054704130 9:68445480-68445502 CTAGATAGTGTGAGGATGCTTGG + Intronic
1055858595 9:80722371-80722393 CAATATAACCTCAGGATGTTAGG - Intergenic
1060096485 9:120795006-120795028 CTAAATGAAGTCAGGATGCTTGG - Intergenic
1203754375 Un_GL000218v1:111020-111042 CCAAATAACTTGAGGTTCCTGGG + Intergenic
1186505530 X:10088911-10088933 CTACATCACCTGAGGGTCCTCGG - Intronic
1187629524 X:21153535-21153557 TTAAAAAACCTGAGGCTACTCGG - Intergenic
1191218911 X:57964728-57964750 CAAGATAACTTGAGGATCCTGGG + Intergenic
1193179456 X:78436702-78436724 CAAGATAACCTGGGGATCCTGGG + Intergenic
1195350788 X:103994960-103994982 CCAAATTACCTGAGGTTCCTGGG - Intergenic
1197072996 X:122322716-122322738 CTAGATAACTTGAGGCTCCTGGG - Intergenic
1197355108 X:125429972-125429994 ATGAACAACCTGAGGAAGCTTGG - Intergenic
1201168006 Y:11228668-11228690 CCAAATAACTTGAGGTTCCTGGG + Intergenic