ID: 1033608006

View in Genome Browser
Species Human (GRCh38)
Location 7:142941510-142941532
Sequence CCTTGGGGCACTTGATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033608006_1033608014 18 Left 1033608006 7:142941510-142941532 CCAGGGGATCAAGTGCCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1033608014 7:142941551-142941573 AATGTATAGTTCATTTAATCTGG 0: 1
1: 0
2: 0
3: 14
4: 231
1033608006_1033608015 25 Left 1033608006 7:142941510-142941532 CCAGGGGATCAAGTGCCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1033608015 7:142941558-142941580 AGTTCATTTAATCTGGCAATAGG 0: 1
1: 0
2: 0
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033608006 Original CRISPR CCTTGGGGCACTTGATCCCC TGG (reversed) Intronic
900566700 1:3335844-3335866 GCATGGGGCACTTGGCCCCCGGG - Intronic
901816119 1:11794462-11794484 CCTTGGGGGACTTGCTCTTCAGG + Exonic
902244015 1:15107440-15107462 CCTTGTGGCACTCTAGCCCCAGG + Intronic
903009321 1:20318963-20318985 CATCGGGGCACTTTACCCCCAGG + Intronic
904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG + Exonic
905873760 1:41419275-41419297 CCTGGGGGCACTTGGCCACCAGG + Intergenic
908257219 1:62312904-62312926 CCTTGAGGCAGTTGATACCGTGG - Intronic
912893156 1:113557299-113557321 CCCTGGGGCACTCCATCCCAGGG - Intronic
915165313 1:153945153-153945175 CCTTGGGGCTCCTACTCCCCGGG - Intronic
915624956 1:157108835-157108857 TCCAGGGTCACTTGATCCCCAGG - Intergenic
922500123 1:226091124-226091146 CCTTGAGGGACTCGTTCCCCAGG + Intergenic
922937519 1:229433388-229433410 TCTTGGGGAACATGTTCCCCTGG - Intronic
1065688437 10:28309013-28309035 CCTTGGGTCAAGTGATCCTCAGG - Intronic
1067578291 10:47421246-47421268 CCTTTGGTCACTTGATGCCAGGG + Intergenic
1069807631 10:71136034-71136056 CCATGGGGCACTGGACACCCTGG + Intergenic
1071471156 10:85984813-85984835 CCATGGGGCACTGGAGCACCTGG + Intronic
1072250155 10:93575521-93575543 CCTTGGGGCTCTAGATGGCCAGG + Intronic
1072662321 10:97370542-97370564 CCTTGGTGCACAGGATCACCTGG + Exonic
1073467423 10:103702355-103702377 CTTTGGGGCACCTGATCACAAGG - Intronic
1074469752 10:113716042-113716064 CCAGGGGGCACCTGATCCCTAGG - Intronic
1077318023 11:1927925-1927947 CCTTGGGGCACATGTGCACCGGG - Intronic
1083300085 11:61735623-61735645 CCTTGGGGGACAGGGTCCCCCGG - Exonic
1084292656 11:68184591-68184613 CCTGGGGGAACTTGATACCCAGG - Intronic
1086741968 11:90379759-90379781 CCTTTAGGCACTTCATCCCATGG + Intergenic
1090521232 11:127481669-127481691 CCTTGAGGCAGTTAATCCCATGG + Intergenic
1093387924 12:18582377-18582399 CCTTGGGTCAGGAGATCCCCTGG + Intronic
1096668746 12:53185067-53185089 GCTTGGGCCACCCGATCCCCAGG - Intronic
1098054690 12:66492477-66492499 CCTTGGCTCTCTTGATTCCCTGG - Intronic
1107225535 13:38044335-38044357 CCTTGGAGCTTTTCATCCCCAGG + Intergenic
1107756957 13:43634962-43634984 CCTTGGGGGAATTAATACCCTGG - Intronic
1112746474 13:102532867-102532889 CCTTGGAGAACTTGATCCGCAGG + Intergenic
1113423263 13:110186393-110186415 CCTGGAGGCCCTGGATCCCCAGG - Exonic
1113848904 13:113407066-113407088 CCTTGGGGCACCGGATCAGCCGG - Intergenic
1113994181 14:16053258-16053280 CTTTGGGGTACCGGATCCCCCGG + Intergenic
1114526035 14:23367300-23367322 CCTTGGTGAACTTGAGGCCCTGG + Intergenic
1115001565 14:28427120-28427142 TCTTGGGGCACATTTTCCCCTGG - Intergenic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119668897 14:76504009-76504031 CCTTGTGCCCCTTGTTCCCCAGG - Intergenic
1122419683 14:101567445-101567467 CATTGGGGCACTTGCTCCGGGGG + Intergenic
1124175157 15:27417543-27417565 CCTGAGGGCACCTGAGCCCCGGG - Intronic
1124910467 15:33915512-33915534 CCTGTGGGCTCTTGGTCCCCAGG + Intronic
1125897607 15:43315661-43315683 CCTGGGGTCAAGTGATCCCCCGG - Intergenic
1131051259 15:89349574-89349596 CATTGGGTCATTTGATCACCGGG - Intergenic
1131573117 15:93559369-93559391 CTTTGGGCCAATTGATACCCTGG + Intergenic
1132314478 15:100879985-100880007 CCTTGGTGAACTTGACCTCCAGG - Exonic
1132767075 16:1539856-1539878 CCCTGGGGCACGGGGTCCCCGGG - Intronic
1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG + Intergenic
1134690898 16:16190562-16190584 CCATGGGGCACATTATCCCAGGG - Intronic
1137547036 16:49411540-49411562 CCTTTGGGGATTTGAACCCCTGG - Intergenic
1138600843 16:58053096-58053118 CCTTTGTCTACTTGATCCCCAGG - Intergenic
1141534567 16:84670176-84670198 CCTTGGCGCACTTCAGCTCCTGG + Intergenic
1142489715 17:270344-270366 CCTTGCGGCACCTGCTTCCCGGG - Intronic
1147541473 17:41363827-41363849 CCTTTGGGTACTAGATACCCTGG - Exonic
1149166321 17:53757435-53757457 CCTTGGAGCACTTAACACCCAGG + Intergenic
1151155588 17:72121535-72121557 CCTTGGGGAACGTGTTCTCCTGG - Exonic
1152264268 17:79284902-79284924 GCTTGGGGCCCTTCATCCTCTGG + Intronic
1152528712 17:80904263-80904285 GCCTGGGGCACTGGTTCCCCAGG + Intronic
1153972056 18:10235886-10235908 CCTTGGTCCACATGGTCCCCAGG + Intergenic
1156156508 18:34308867-34308889 CCCTCAGGCACTTGATCCACTGG + Intergenic
1160351750 18:78188319-78188341 CATTAGGGCACTTGCTCCCATGG + Intergenic
1160929954 19:1565993-1566015 CCTTTGGTCACTTGGTCCCCAGG + Intronic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1162966977 19:14160647-14160669 CCTTGGGGCTCTGGAACCCCCGG - Exonic
1166844356 19:45717704-45717726 CCTTGGTGTTCTTAATCCCCGGG - Intronic
1167247498 19:48382672-48382694 CCTTCCCGCACTTGAGCCCCGGG + Exonic
1168267643 19:55231199-55231221 GCTTGGGGCCCTTGAGCCCCAGG - Intronic
1168343611 19:55640298-55640320 TCCTGGGGCACTTGAGGCCCGGG - Intronic
925675831 2:6360235-6360257 CTTTGGGGCACTGGATCACAGGG + Intergenic
925778652 2:7359032-7359054 CCTTGTGGCTCTTCTTCCCCTGG + Intergenic
929800107 2:45092579-45092601 CCTTGGGGGACCTGCTCCCTGGG + Intergenic
931214217 2:60226311-60226333 CCTTGGGGTGCCTGATCCCTGGG - Intergenic
932492593 2:72131598-72131620 CCTTGGGGCAAAGGAGCCCCAGG - Exonic
936519325 2:113201856-113201878 CCTTGGGGCTGTGGCTCCCCTGG - Exonic
938537469 2:132257612-132257634 CTTTGGGGTACCGGATCCCCCGG - Intronic
939366532 2:141240237-141240259 CCTTTGGGCACTCCTTCCCCTGG - Intronic
944285133 2:197941235-197941257 CATGGGGGCACTTGCTTCCCAGG - Intronic
945811289 2:214553308-214553330 ACTTTGGGCACATGATCCCCTGG - Intronic
947352851 2:229264449-229264471 CCTTGTGGCCCTTGATCACTTGG - Intronic
948760127 2:240185140-240185162 CCATGGAGCAGTTGCTCCCCGGG - Intergenic
1168964442 20:1890807-1890829 TCTTGGGGCAGTTGGTTCCCTGG + Intergenic
1169921251 20:10736331-10736353 CCTTGCTGCACTTGCTTCCCAGG - Intergenic
1170907231 20:20527494-20527516 GCTTGGAACACTTAATCCCCAGG + Intronic
1171567530 20:26208837-26208859 CCTTGGGGTACGGGATCCCCCGG - Intergenic
1172689150 20:36778583-36778605 CCTTGGGGCACCACATCACCTGG + Exonic
1179564087 21:42235472-42235494 CCTTTGGGCACGTGTTCTCCTGG - Intronic
1180313088 22:11254257-11254279 CTTTGGGGTACCGGATCCCCCGG - Intergenic
1181293922 22:21819699-21819721 CCTTGGGTCACTTGAGCCTGGGG - Intronic
1182458565 22:30468603-30468625 CATTGGGCCACTTGATCCCAAGG - Exonic
951171151 3:19543287-19543309 CCTTGGTCCACTTGAACCTCTGG - Intergenic
954440846 3:50521239-50521261 CCTTGGGGGACTGGAGCCCTGGG - Intergenic
954732995 3:52681008-52681030 CCTTGGGGCCTCTGAACCCCAGG - Intronic
956726027 3:72157126-72157148 CATGGGGGAACATGATCCCCGGG + Intergenic
961013550 3:123450271-123450293 CCTTGAGGCACTCGCTGCCCAGG - Intergenic
961904345 3:130247033-130247055 CTTTGGGGCCCTTTATACCCTGG - Intergenic
964490530 3:157231030-157231052 CAGTGGGACAATTGATCCCCAGG - Intergenic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
976817812 4:89170676-89170698 TCTTGGCGCACTTGATTCCATGG - Intergenic
977607061 4:98994594-98994616 CCTTGGTGCCCTGGATGCCCTGG + Intergenic
980595772 4:134952634-134952656 CCTTGGAGCACTTAACACCCAGG + Intergenic
990991429 5:61688252-61688274 CCATGGGGCTCTTGAGTCCCAGG - Intronic
992861981 5:80920560-80920582 CCTTGGGGCACTTCCTACCTGGG + Intergenic
995148275 5:108811015-108811037 ACTTGGAGCACTTGCTCACCTGG - Intronic
999114301 5:149148920-149148942 TCTTGGTGCACTTGATGCTCTGG - Intronic
999573069 5:152942775-152942797 CCCTGGGGCATTTGATTCCCAGG - Intergenic
999573114 5:152943137-152943159 CCCTGGGGCATTTGATTCCCAGG - Intergenic
1001299023 5:170520391-170520413 CCTTGGGGAAATTAAGCCCCAGG + Intronic
1001981885 5:176043731-176043753 CCTTGGACCTCTTGATCCTCTGG + Intergenic
1002043266 5:176529155-176529177 CCTGGGGGGACTTGGTCCGCTGG + Intronic
1002235580 5:177800326-177800348 CCTTGGACCTCTTGATCCTCTGG - Intergenic
1002299083 5:178247525-178247547 CCTTGGGACCCTGGATTCCCTGG + Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002859487 6:1067557-1067579 CCTTGGAGCATGTCATCCCCAGG + Intergenic
1003561190 6:7182022-7182044 TCGAGGGGGACTTGATCCCCTGG - Exonic
1006870430 6:37246348-37246370 CCTTGGGCCAGTAGCTCCCCAGG + Intronic
1012676137 6:102115360-102115382 ACTTGGAGCACTTGCTCACCTGG - Intergenic
1012678949 6:102154192-102154214 CCTTGGGGTCCTTGATTCCAGGG + Intergenic
1013791722 6:113844757-113844779 CTTTGGGGAATTTGCTCCCCTGG - Intergenic
1016220825 6:141668306-141668328 ACTTGGGGCACATGTTTCCCTGG + Intergenic
1016423818 6:143913140-143913162 CCTCTGGGCACTTCATCCCAGGG + Intronic
1019599165 7:1872990-1873012 ACTTTGGGGACTTTATCCCCAGG + Intronic
1026849982 7:73718427-73718449 CCTTTGGGCATTTGACCCCACGG - Intronic
1027187655 7:75981603-75981625 CCTGCGGGCACTTGCTCACCTGG - Exonic
1030063134 7:105639053-105639075 CCTTGGGTCAGCTGTTCCCCTGG + Intronic
1033143668 7:138851873-138851895 TCTTGGGCCACTTTTTCCCCAGG - Intronic
1033272773 7:139947629-139947651 CCTTGGGGAATTTGCTTCCCAGG + Intronic
1033277986 7:139987131-139987153 CCTTGGGGAGCTTGATGCCTGGG + Intronic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1034422673 7:150997565-150997587 CCATGGGGGACTTGGTCCCATGG + Intronic
1034980270 7:155471411-155471433 CCTTGGGGCTCTGAATCCACAGG - Intergenic
1035093099 7:156330810-156330832 CCTTGGGGCACTTGCCCTCTTGG - Intergenic
1038455939 8:27672007-27672029 CCTTGGGGCTTTTCAACCCCAGG - Exonic
1047309469 8:123679650-123679672 CCTTGGGGCAGTTCATTCCCAGG - Intergenic
1047341499 8:123984822-123984844 CAATGGAGCTCTTGATCCCCGGG + Intronic
1048968075 8:139628430-139628452 CCATGGAGAACTTGAGCCCCAGG + Intronic
1051687762 9:19676018-19676040 CCTATGGGCTCTTGGTCCCCAGG - Intronic
1053310960 9:37019431-37019453 CTTTGGGGACCTTGATCCCAGGG - Intronic
1055993351 9:82131177-82131199 CCTTGGAGCACTTAACACCCAGG - Intergenic
1056927363 9:90846296-90846318 CCCTGGGGGAAATGATCCCCTGG + Intronic
1057225129 9:93289148-93289170 CCTTGGGGCACTGGCGTCCCTGG - Exonic
1058166774 9:101627888-101627910 CCTTGGGACACTTTATCCTCTGG + Intronic
1059054760 9:110967860-110967882 CATTGGGTCACTTGGTTCCCAGG - Intronic
1060220648 9:121762454-121762476 CCTCAGGCCACATGATCCCCAGG + Intronic
1060679856 9:125552720-125552742 CCTGGGGGCTCTTGAACCTCAGG - Intronic
1060748758 9:126155079-126155101 CCTGGGGGCATTTGCGCCCCAGG - Intergenic
1185966360 X:4608366-4608388 CCTTGGTCCACTTGATTGCCAGG - Intergenic
1190912819 X:54788253-54788275 CCTTTGGGCACTTGATTCACTGG + Intronic
1190918135 X:54825123-54825145 CCTTTGGGCACTTGATTCACTGG - Intergenic
1196245356 X:113392568-113392590 CCTGGGAGCATTGGATCCCCTGG - Intergenic
1200123961 X:153804561-153804583 CCAGGTGGCACTTGATCTCCAGG + Exonic
1200336182 X:155353691-155353713 CCTTGGGTCAGGAGATCCCCTGG + Intergenic
1200350288 X:155487536-155487558 CCTTGGGTCAGGAGATCCCCTGG - Intergenic