ID: 1033611829

View in Genome Browser
Species Human (GRCh38)
Location 7:142970620-142970642
Sequence CTGTCAGAGGTGCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033611816_1033611829 11 Left 1033611816 7:142970586-142970608 CCTCACTGGACAATAAAGAGGCC No data
Right 1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG No data
1033611817_1033611829 -10 Left 1033611817 7:142970607-142970629 CCCCCATCCCCTCCTGTCAGAGG No data
Right 1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG No data
1033611814_1033611829 24 Left 1033611814 7:142970573-142970595 CCAGAAATTTCATCCTCACTGGA No data
Right 1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033611829 Original CRISPR CTGTCAGAGGTGCTGGTGGA GGG Intergenic
No off target data available for this crispr