ID: 1033614908

View in Genome Browser
Species Human (GRCh38)
Location 7:143004715-143004737
Sequence ATTTGAGGAGGTACCACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033614908_1033614918 30 Left 1033614908 7:143004715-143004737 CCAAAAGTGGTACCTCCTCAAAT No data
Right 1033614918 7:143004768-143004790 AACAAGCACAGGAATTGAAGGGG No data
1033614908_1033614916 28 Left 1033614908 7:143004715-143004737 CCAAAAGTGGTACCTCCTCAAAT No data
Right 1033614916 7:143004766-143004788 TTAACAAGCACAGGAATTGAAGG No data
1033614908_1033614911 -3 Left 1033614908 7:143004715-143004737 CCAAAAGTGGTACCTCCTCAAAT No data
Right 1033614911 7:143004735-143004757 AATGAGACCCCAGCACTGAGAGG No data
1033614908_1033614915 19 Left 1033614908 7:143004715-143004737 CCAAAAGTGGTACCTCCTCAAAT No data
Right 1033614915 7:143004757-143004779 GCTGTAAGTTTAACAAGCACAGG No data
1033614908_1033614917 29 Left 1033614908 7:143004715-143004737 CCAAAAGTGGTACCTCCTCAAAT No data
Right 1033614917 7:143004767-143004789 TAACAAGCACAGGAATTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033614908 Original CRISPR ATTTGAGGAGGTACCACTTT TGG (reversed) Intergenic