ID: 1033617349

View in Genome Browser
Species Human (GRCh38)
Location 7:143029362-143029384
Sequence GTTGCTGCAATCCCCACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033617347_1033617349 -1 Left 1033617347 7:143029340-143029362 CCATGCACAGGGGCCAGAACAAG No data
Right 1033617349 7:143029362-143029384 GTTGCTGCAATCCCCACTCATGG No data
1033617341_1033617349 22 Left 1033617341 7:143029317-143029339 CCTCCTGTCCTGCTAGTGCTGAG No data
Right 1033617349 7:143029362-143029384 GTTGCTGCAATCCCCACTCATGG No data
1033617342_1033617349 19 Left 1033617342 7:143029320-143029342 CCTGTCCTGCTAGTGCTGAGCCA No data
Right 1033617349 7:143029362-143029384 GTTGCTGCAATCCCCACTCATGG No data
1033617343_1033617349 14 Left 1033617343 7:143029325-143029347 CCTGCTAGTGCTGAGCCATGCAC No data
Right 1033617349 7:143029362-143029384 GTTGCTGCAATCCCCACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033617349 Original CRISPR GTTGCTGCAATCCCCACTCA TGG Intergenic