ID: 1033617356

View in Genome Browser
Species Human (GRCh38)
Location 7:143029397-143029419
Sequence ATGTCCTCCCAGAGGAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033617353_1033617356 0 Left 1033617353 7:143029374-143029396 CCCACTCATGGCGAAGAAGGGAA No data
Right 1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG No data
1033617354_1033617356 -1 Left 1033617354 7:143029375-143029397 CCACTCATGGCGAAGAAGGGAAA No data
Right 1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG No data
1033617348_1033617356 21 Left 1033617348 7:143029353-143029375 CCAGAACAAGTTGCTGCAATCCC No data
Right 1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG No data
1033617352_1033617356 1 Left 1033617352 7:143029373-143029395 CCCCACTCATGGCGAAGAAGGGA No data
Right 1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033617356 Original CRISPR ATGTCCTCCCAGAGGAGCTT AGG Intergenic
No off target data available for this crispr