ID: 1033619723

View in Genome Browser
Species Human (GRCh38)
Location 7:143051346-143051368
Sequence CTGCTTCGTGTTTGCAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033619723_1033619727 7 Left 1033619723 7:143051346-143051368 CCATCTTTGCAAACACGAAGCAG No data
Right 1033619727 7:143051376-143051398 CTCTAAAGGAAGTTAATTTCTGG No data
1033619723_1033619725 -7 Left 1033619723 7:143051346-143051368 CCATCTTTGCAAACACGAAGCAG No data
Right 1033619725 7:143051362-143051384 GAAGCAGAGGTCTCCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033619723 Original CRISPR CTGCTTCGTGTTTGCAAAGA TGG (reversed) Intergenic
No off target data available for this crispr