ID: 1033622668

View in Genome Browser
Species Human (GRCh38)
Location 7:143076358-143076380
Sequence GCTTCTTTTGGAGGATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033622661_1033622668 16 Left 1033622661 7:143076319-143076341 CCAGGGATAAGGCACTTTTGCCC No data
Right 1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG No data
1033622665_1033622668 -5 Left 1033622665 7:143076340-143076362 CCATGGAGAAGGAACTGTGCTTC No data
Right 1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG No data
1033622664_1033622668 -4 Left 1033622664 7:143076339-143076361 CCCATGGAGAAGGAACTGTGCTT No data
Right 1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033622668 Original CRISPR GCTTCTTTTGGAGGATGAGC TGG Intergenic
No off target data available for this crispr