ID: 1033629451

View in Genome Browser
Species Human (GRCh38)
Location 7:143142300-143142322
Sequence AAAAAATTAGCCAGGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391208
Summary {0: 119, 1: 10443, 2: 56689, 3: 130269, 4: 193688}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629451_1033629461 30 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629461 7:143142353-143142375 GAGCCTCACTATGTTGCCTAGGG No data
1033629451_1033629460 29 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629460 7:143142352-143142374 GGAGCCTCACTATGTTGCCTAGG No data
1033629451_1033629458 7 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629458 7:143142330-143142352 TTTTTGTAGAGATTGGGCAGGGG No data
1033629451_1033629459 8 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data
1033629451_1033629457 6 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG No data
1033629451_1033629456 5 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629456 7:143142328-143142350 ACTTTTTGTAGAGATTGGGCAGG No data
1033629451_1033629454 0 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629451_1033629455 1 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629455 7:143142324-143142346 AAAAACTTTTTGTAGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629451 Original CRISPR AAAAAATTAGCCAGGTGAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr