ID: 1033629452

View in Genome Browser
Species Human (GRCh38)
Location 7:143142303-143142325
Sequence TTAAAAAAATTAGCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293673
Summary {0: 109, 1: 1483, 2: 30513, 3: 85433, 4: 176135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629452_1033629461 27 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629461 7:143142353-143142375 GAGCCTCACTATGTTGCCTAGGG No data
1033629452_1033629458 4 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629458 7:143142330-143142352 TTTTTGTAGAGATTGGGCAGGGG No data
1033629452_1033629459 5 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data
1033629452_1033629456 2 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629456 7:143142328-143142350 ACTTTTTGTAGAGATTGGGCAGG No data
1033629452_1033629460 26 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629460 7:143142352-143142374 GGAGCCTCACTATGTTGCCTAGG No data
1033629452_1033629463 30 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629463 7:143142356-143142378 CCTCACTATGTTGCCTAGGGTGG No data
1033629452_1033629454 -3 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629452_1033629455 -2 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629455 7:143142324-143142346 AAAAACTTTTTGTAGAGATTGGG No data
1033629452_1033629457 3 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629452 Original CRISPR TTAAAAAAATTAGCCAGGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr